Расширенный геном: Расширенный геном

Содержание

Расширенный геном

Статья на конкурс «био/мол/текст»: «Создана новая жизнь из пробирки» — такому заголовку уже явно не стать сенсацией в XXI веке; современные ученые успели развить такое громкое научное направление, как генная инженерия, в целую научно-философскую концепцию под названием синтетическая биология.

Обратите внимание!

Эта работа опубликована в номинации «лучшая обзорная статья» конкурса «био/мол/текст»-2015.


Спонсором номинации «Лучшая статья о механизмах старения и долголетия» является фонд «Наука за продление жизни». Спонсором приза зрительских симпатий выступила фирма Helicon.


Спонсоры конкурса: Лаборатория биотехнологических исследований 3D Bioprinting Solutions и Студия научной графики, анимации и моделирования Visual Science.

С синтетической биологией связаны основные надежды решения проблем биомедицины и персонифицированной медицины, методов лечения генетических заболеваний, а также разработка инновационных фармацевтических препаратов и даже создание новых материалов с заданными свойствами. Так, например, компания Bolt Threads развивает направление по созданию новых революционных материалов на основе паучьих нитей. Давно известно, что паутина лучше любого материала: она в несколько раз прочнее стали и кевлара, но в то же время это очень эластичный, гибкий и износостойкий материал. Усилиями научного коллектива компании Bolt Threads создан генетически модифицированный микроорганизм, который синтезирует уникальный белок со свойствами, близкими к свойствам паутины. Модифицируя этот белок, можно получать нити с разной эластичностью и прочностью — самый настоящий искусственный биополимер. Так что не за горами появление одежды тонкой, как шелк, и прочной, как бронежилет* [1].

Возвращение к истокам

Ядро концепции синтетической биологии составляет возможность использовать молекулы ДНК, а именно, составляющие ее элементы — нуклеотиды аденин, гуанин, цитозин и тимин — как строительные кирпичики для манипуляций по созданию абсолютно новых биологических конструкций, ранее не существовавших в природе [3]. Но, как оказалось, этих природных инструментов и механизмов ученым уже мало для работы, они спешат вслед за фантазиями футурологов об искусственной жизни и активно взялись за работу по расширению генетического кода — а там, глядишь, недалеко и до создания полностью синтетического кода с принципиально новым устройством. Ну а пока остановимся на тех разработках, что уже ведутся в этой области.

Вспоминая центральную догму молекулярной биологии, повторим, что реализация генетической информации, заложенной в молекуле ДНК, осуществляется через белковые молекулы, на язык которых она переводится посредством процессов репликации, транскрипции и трансляции. Даже при существующей организации живой материи, казалось бы, есть неограниченные возможности для осуществления самых буйных фантазий синтетических биологов. Смотрите сами: генетический код состоит из четырех основных нуклеотидов*, затем информация перекодируется на язык РНК в процессе транскрипции, а далее кодонами (тройками рибонуклеотидов) переводится в аминокислотные последовательности — первичные полипептидные молекулы. Так как типов нуклеотидов четыре, то общее разнообразие кодонов будет 43 = 64, в них закодированы 20 протеиногенных (природных) аминокислот (АК) (не считая редкие АК: пирролизин, кодируемый генами некоторых метаногенных архей, и селеноцистеин, входящий в состав селенопротеинов и нескольких других белков). А это дает возможное разнообразие белковых молекул 20n (где n — число аминокислотных остатков), то есть бесчисленное множество вариантов [4]. Однако и этого ученым оказывается мало: им хочется узнать, как изменится функциональность белковых молекул, какие новые свойства могут приобрести белки, если в их состав включить искусственные, «неприродные», АК — те, что выходят за канонический ряд двадцатки и не синтезируются внутри живых организмов. И вот для осуществления таких амбициозных задач природой заложено не так уж много возможностей.

Как известно, осуществление процесса трансляции в клетках обеспечивают рибосомы, узнающие трехбуквенные кодоны на матричной РНК (мРНК) и сопоставляющие с ними соответствующие антикодоны транспортных РНК (тРНК), несущих АК. Молекула тРНК присоединяет АК с помощью фермента аминоацил-тРНК-синтетазы. Таким образом, специфичность трансляции определяется взаимодействием между кодоном мРНК и антикодоном тРНК, а также специфичностью работы аминоацил-тРНК-синтетаз. Терминация синтеза белка осуществляется, когда в сайте узнавания рибосомы оказывается один из стоп-кодонов — UAG, UAA, UGA. У них, кстати, есть свои интересные названия: UAG — амбер, или янтарь (amber), UAA — охра (ochre), UGA — опал (opal). Им не соответствует ни одна из тРНК, и в действие вступают специфические белки-терминаторы RF1 или RF2, которые катализируют отсоединение полипептидной цепи от мРНК.

От природного к искусственному

Рисунок 1. Схематичная карта отредактированного генома E. coli, в котором провели замену 321 амбер-кодона на охра-кодоны с элиминированием фактора терминации RF1. Рисунок из [8].

Для того чтобы включить новую, искусственную АК в генетический код, требуются изменения отлаженной системы. Во-первых, для успешного ввода новой АК необходим «пустой» кодон, который будет кодировать эту АК. Но где его взять? Ведь все 64 кодона мРНК плотно задействованы в работе: 61 из них кодирует природные АК, а оставшиеся три — стоп-кодоны. Во-вторых, нужна новая ортогональная пара тРНК и аминоацил-тРНК-синтетазы (такая, которая клеткой не производится, «не вмешивается» в природные процессы биосинтеза белка, а предназначена лишь для работы с искусственными АК): новая молекула тРНК должна точно узнавать и присоединять искусственную АК, а новая аминоацил-тРНК-синтетаза — эффективно катализировать именно эту реакцию. Затем аминоацилированная тРНК должна точно доставлять АК к «пустому» кодону.

При исследовании штаммов Escherichia coli (E. coli) было обнаружено, что в их геномах не все стоп-кодоны используются с одинаковой частотой. Например, амбер-кодон UAG встречается реже остальных и составляет около 8% от общего числа стоп-кодонов. В рамках исследования его значимости для бактерии в 1990 году был получен первый жизнеспособный штамм E. coli, у которого был подавлен один амбер-кодон, то есть последовательность прочитывалась сквозь него [6]. В лаборатории П. Шульца (Peter G. Schultz) из Исследовательского института Скриппса смогли в E. coli вставить соответственно амбер-кодону обычную, протеиногенную, АК тирозин, а затем и некоторые искусственные АК [7]. Еще позже исследовательской группой профессора Джорджа Чёрча (George McDonald Church) из Гарварда была проведена масштабная работа по всеобъемлющему редактированию генома E. coli с целью замены всех амбер-кодонов на охра-кодоны: UAG → UAA. Это было сделано с помощью мощного современного метода мультиплексного геномного редактирования (MAGE), который позволяет проводить полномасштабные манипуляции с геномом при помощи синтетических одноцепочечных олигонуклеотидов (рис. 1) [8].

Такая модификация затронула 83 пептида бактерии, но новый генно-модифицированный штамм E. coli C321.ΔA получился не просто жизнеспособным, но и обладал повышенной устойчивостью к бактериофагу T7. Это означает, что у такого организма есть расширенные возможности относительно использования амбер-кодонов в новых целях. Так, например, одно из направлений работы — модификация этого штамма в синтетический ауксотроф — организм, зависимый от какого-нибудь органического соединения, в нашем случае — от искусственных АК. Зачем это нужно? В последнее время развиваются опасения, что генно-модифицированные организмы (ГМО), и в первую очередь микроорганизмы, могут распространиться за пределы исследовательских лабораторий и выйти из-под контроля ученых. Это можно предупредить приданием ГМО зависимости от искусственных АК, которые бы заменяли протеиногенные АК в жизненно важных для организма белках. Соответственно, такой штамм не смог бы развиваться на средах без источника аминокислоты, от которой зависим.

Для одновременного эффективного кодирования нескольких неприродных АК требуется больше «пустых» кодонов и ортогональных пар аминоацил-тРНК-синтетаз и тРНК, которые бы «признавали» неприродные АК и декодировали новые кодоны. Поэтому следующим логичным шагом стали попытки расширения триплетного генетического кода до квадруплетного [7]. Использование квадруплетного кода гипотетически увеличило бы количество кодонов до 256 (= 44) [4]. Но для распознавания таких кодонов нужна модификация всего трансляционного аппарата: изменение тРНК для расширения антикодоновой петли, новые аминоацил-тРНК-синтетазы, катализирующие присоединение неприродных АК к молекулам тРНК, новые рибосомы с расширенным сайтом узнавания, способным вмещать укрупненный комплекс аминоацил-тРНК-молекул [9]. Такая ортогональная квадруплетная рибосома была создана и работала в сочетании с особой мРНК [7], никак не влияя на «природный» биосинтез белка обычными клеточными рибосомами. А значит, не затрагивая нормальную внутриклеточную жизнь, можно создавать в клетке абсолютно новые трансляционные пути — синтезировать белковые молекулы, состоящие частично или даже полностью из неприродных АК, некие новые биополимеры. В общем, ученые показали, что отправной точкой таких исследований является эволюция рибосомы.

Немного информатики на закуску

К рассмотрению генетического кода можно применять теории и понятия из других научных областей. Так, например, приложение теории информации может помочь нам ответить на главный вопрос: действительно ли расширение генетического кода расширяет его информационную ёмкость? Иначе зачем проводить все эти масштабные исследования? Мерой количества информации служит степень разнообразия элементов системы или сведений о ней. А поскольку задачей расширения генетического кода как раз и является углубление и расширение информационной ёмкости генетического кода, то нужен расчет, который бы количественно отразил закодированную информацию. Таким расчетом может служить расчет показателя энтропии Шеннона для первичной аминокислотной последовательности. Он может дать представление о том, сколько информации теоретически закодировано в ней.

Общая формула для него:
где i — буква алфавита, pi — частота встречаемости буквы алфавита в последовательности; количество информации измеряется в битах.

Вообще говоря, понятие энтропии пришло из термодинамики открытых систем и определяется как мера неопределенности системы. А информация может рассматриваться как мера упорядоченности. Соответственно, процесс накопления информации — необходимое условие для снятия неопределенности. Энтропия Шеннона будет принимать высокие значения для последовательностей, содержащих максимальное число различных типов АК, в которых все типы АК распределены наиболее равномерно, — последовательностей с максимальным объемом информации. Это объясняется следующим примером: для очень однородной последовательности (например, полиаланиновой цепочки), зная положение конкретной АК в последовательности и зная, что каждая из них — это аланин, расчет энтропии Шеннона даст 0 бит информации (H = log21 = 0). Неопределенность в такой системе сведена к минимуму, так как мы знаем, что любая АК в цепочке — аланин. В то же время в таком сложном белке, как кальмодулин, в котором представлены 18 из 20 возможных типов АК, показатель Шеннона составит 3,9 бита от максимально возможных 4,3 бит (H = log220 ≈ 4,3), информационная нагрузка такой цепочки в разы возрастает (рис. 2).

Рисунок 2. Примеры величины энтропии Шеннона для разных пептидов: а — максимальное значение энтропии Шеннона при однородном распределении АК в гипотетической полипептидной цепочке, б — минимальное значение — например, в полиаланиновой цепочке. Рисунок из [4].

То есть, если теоретически можно будет составлять белковые молекулы из 255 типов АК, то информационная ёмкость на один шаг должна увеличиться до 8 бит (H = log2255 ≈ 7,99) [4]. Математические расчеты — это, конечно, хорошо, но как представление о количестве теоретически закодированной информации соотнести с функциональностью молекул? Будет ли это отражаться на биологической активности молекул, составленных из белковых последовательностей с большей информационной ёмкостью? То есть возникает вопрос о корреляции энтропии Шеннона белковых последовательностей с их биологической функцией.

Частично ответ на этот вопрос пришел из исследований, посвященных изучению эволюции РНК-мира — того раннего этапа жизни, когда молекулы РНК служили хранилищами генетической информации и основой для построения каталитических молекул [10, 11]. Используя стандартный алфавит (аденин, гуанин, цитозин и урацил), in vitro получали высокоактивные рибозимы с константой скорости каталитической реакции kcat = 20 мин−1. Далее алфавит уменьшали, первым элиминируя цитозин, так как он наименее стабилен (наиболее подвержен разложению). Такое сокращение по-прежнему давало рибозимы, но уже с более низкой каталитической активностью: kcat = 0,01 мин−1. Сокращение алфавита до двух букв — это крайний из возможных вариантов, которым можно передавать информацию; в таком случае получались рибозимы с kcat = 0,001 мин−1. Однако и это значение всё еще в 10000 раз превышало константу скорости некаталитической реакции. Примечательно, что этот рибозим состоял из урацила (U) и неприродного основания диаминопурина (D). Оказалось, что преимущество D-U-системы над А-U-системой состоит в том, что неприродная пара оснований формирует три, а не две, водородные связи во время гибридизации, тем самым стабилизируя вторичную структуру рибозима.

Хотя открытие рибозимов только с двумя или тремя видами оснований и само по себе довольно интересно, оно еще послужило подтверждением предположения, что уменьшение размера алфавита снижает активность биомолекул. А следовательно, теоретически заложенная информация соотносится с функциональной активностью, подтверждая интуитивное предположение: чем больше информации, тем лучше. Поэтому в ближайшие годы можно ожидать еще больше статей с сенсационными исследованиями на тему расширения генетического кода.

Пятое колесо в телеге

Еще одна исследовательская группа под руководством доктора Ф. Ромесберга (Floyd E. Romesberg) проделала поистине революционную работу: им удалось создать полусинтетический штамм E. coli с искусственной нуклеотидной парой, которая реплицировалась с высокой точностью, сохранялась и передавалась по наследству [12]. То есть эта нуклеотидная пара распознавалась ферментными структурами клетки как «своя» (не чужеродная) и не редактировалась системами репарации. Но обо всём по порядку.

Сначала синтетическими методами был получен ряд нуклеотидных аналогов и среди них выбрана потенциальная пара для включения в ДНК. Эти искусственные нуклеотиды получили кодовые названия d5SICS и dNaM; водородные связи в этой паре не образовывались, а комплементарность обеспечивалась гидрофобными взаимодействиями. Оказалось, что такая вставка не нарушает природную Уотсон-Криковскую структуру молекулы ДНК и не препятствует работе полимеразы (рис. 3). In vitro, то есть в пробирках, была проверена амплифицируемость ДНК-фрагментов, содержащих искусственную нуклеотидную пару, и наилучшие результаты показала Taq-полимераза. Ура! часть работы была выполнена, настало время переходить к экспериментам in vivo — а это самое сложное.

Рисунок 3. Искусственная нуклеотидная пара d5SICS-dNaM (а) в сравнении с естественной парой цитозина-гуанина (б). Рисунок из [12].

Для проверки гипотезы о возможной работе искусственной нуклеотидной пары в клетке (в E. coli) была сконструирована плазмида pINF (рис. 4) из стандартного лабораторного вектора pUC19: методом твердофазного синтеза был получен олигонуклеотид с искусственным основанием, затем с помощью кольцевой ПЦР с перекрывающимися концами (circular extension PCR overlap) искусственная пара была вставлена по 505 положению в вектор. Такое положение искусственных нуклеотидов в векторе было выбрано не случайно. Из внутренних полимеразных ферментов E. coli — а их у нее целых 5 — с наибольшей точностью для искусственных оснований работала ДНК-полимераза I. Но основную работу по репликации бактериального генома осуществляет ДНК-полимераза III, а ДНК-полимераза I выполняет лишь вспомогательную функцию по замене РНК-затравок и заполнению пропусков между фрагментами Оказаки на отстающей цепи («−» цепь ДНК). Поэтому положение искусственных оснований выбрали так, чтобы на «+» цепи ДНК они располагались сразу после сайта origin (места начала репликации), а на «−» цепи — в интервале между фрагментами Оказаки: для уверенности, что эти нуклеотиды попадут в «зону ответственности» ДНК-полимеразы I.

Рисунок 4. Карты плазмидных векторов pACS и pINF. Рисунок из [10].

Рисунок 5. Третья пара нуклеотидов в генетическом коде. Рисунок с сайта www.experientiadocet.com.

Но для успешной высокоточной репликации искусственной нуклеотидной пары необходимо где-то добывать соответствующие искусственные дезоксирибонуклеозидтрифосфаты (дНТФ). Внутри клетки сами по себе они не синтезируются — на то они и искусственные, — поэтому остается добавлять их в среду, на которой будут расти колонии E. coli. А для этого у бактерии должен быть эффективный транспортер искусственных дНТФ внутрь клетки. Поэтому пришлось сконструировать еще одну плазмиду — pACS (рис. 4), содержащую заимствованный у диатомей Protochlamydia amoebophila ген, кодирующий дНТФ-транспортер. Предварительно, разумеется, ученые протестировали, эффективно ли этот транспортер доставлял нужные искусственные дНТФ.

После трансформации сконструированными плазмидами pINF и pACS клетки E. coli выращивали на среде с добавлением искусственных дНТФ. Анализ на «удерживание» искусственных нуклеотидов проводился после 15 часов роста бактерий, что соответствовало минимально 24 клеточным удвоениям. Для достоверного анализа выбрали сразу несколько параллельных методов: ВЭЖХ/МС-анализ (жидкостная хроматография с масс-детекцией), секвенирование по Сенгеру, ПЦР с биотинированными праймерами. С помощью этих методов выяснилось, что точность репликации составила 99,4% (выход искусственных нуклеотидов — 0,86). Такая точность — 1 ошибка на 1000 пар нуклеотидов — характерна для работы некоторых полимераз с полностью природными ДНК. К третьему дню роста бактериальной культуры удерживание искусственных нуклеотидов падало до 45%, а к шестому — до 15%. Но и это исследователи считают прекрасным результатом! Они предполагают, что это только первые шаги в направлении расширения генетического кода. Следующим этапом может стать разработка механизма транскрипции последовательности ДНК с искусственным нуклеотидом в РНК-последовательность. Это помогло бы расширить функциональные возможности разнообразных РНК-структур, например, РНК-переключателей (riboswitches) — активных участков молекул РНК, регулирующих работу генов [13] или рибозимов. Но, конечно, главная идея всей затеи состоит в создании новых триплетных кодонов, способных закодировать синтетические АК (рис. 5), но для этого потребуется и перестройка трансляционного аппарата организмов.

Таким образом, синтетическая биология обладает огромными возможностями в создании и исследовании совершенно «новой» основы жизни, с потенциально новыми свойствами, ранее не существовавшими в природе. Не исключено, что нам удастся дожить до времен, когда всё будет ограничиваться лишь фантазией ученых.

  1. Сайт компании Bolt Threads;
  2. Археи «хамят» и помогают;
  3. Синтетическая жизнь;
  4. Chen I.A. and Schindlinger M. (2010). Quadruplet codons: one small step for a ribosome, one giant leap for proteins. Bioessays32, 650–654;
  5. Шестое ДНК-основание: от открытия до признания;
  6. Normanly J., Kleina L.G., Masson J.M., Abelson J., Miller J.H. (1990). Construction of Escherichia coli amber suppressor tRNA genes. III. Determination of tRNA specificity. J. Mol. Biol. 213, 719–726;
  7. Слово из четырёх букв;
  8. Haimovich A.D., Muir P., Isaacs F.J. (2015). Genomes by design. Nat. Rev. Genet16, 501–516;
  9. Wang L., Brock A., Herberich B., Schultz P.G. (2001). Expanding the genetic code of Escherichia coli. Science292, 498–500;
  10. Levy M. and Miller S.L. (1998). The stability of the RNA bases: implications for the origin of life. Proc. Natl. Acad. Sci. USA. 95, 7933–7938;
  11. Rogers J. and Joyce G.F. (1999). A ribozyme that lacks cytidine. Nature402, 323–325;
  12. Malyshev D., Dhami K., Lavergne T., Chen T., Dai N., Foster J.M., Corrêa I.R. Jr. et al. (2014). A semi-synthetic organism with an expanded genetic alphabet. Nature509, 385–388;
  13. РНК у истоков жизни?.

Готовый перевод Наруто: Система Шиноби / Наруто: Система Шиноби: Глава 119: Расширенный Геном :: Tl.Rulate.ru

Как только обмен на Расширенный Геном завершился, Шикамару недолго думая закинул пилюлю укрепления состояния в рот. Эта пилюля должна была погасить всё боль примерно на сорок процентов, если судить по описанию. Шикамару точно не знал как повлияет на него приобретение Расширенного Генома, но вполне вероятно, что это может оказаться очень болезненно, лучше было подстраховаться сейчас, а заодно узнать весь эффект этих пилюль.

Спустя минуту пилюля подействовала, а Расширенный Геном начал усваиваться и менять организм. Умение преобразовывать чакру в особые стихии происходило из Генов, зачастую обладатель Расширенного Генома владел и Улучшенным, но в случае Шикамару хоть так и было, но его Геном не был связан с Расширенным, как например, был связан у того же Ооноки. Гены менялись, всё же хоть чакра у людей почти всегда похожа, то, как они её замешивает и используют всегда отличается. Особые преобразования зависят от генетики. В прошлые времена Улучшенные Геномы были не редкость, но со временем появлялись совершенно новые, а старые исчезали на войне. Сейчас же Шикамару приобретал очень древний Расширенный Геном. Даже записей о нём он не нашёл, но судя из описания в системе — он позволял владеть металлами. Хоть он и знал применение Стихии Пыли и её мощь, Шикамару всё же готов был рискнуть, ведь он совершенно не видел себя в управлении Пылью, а получить что-то уникальное тоже было неплохо. Обладая Шаринганом и Шикоцумьяку, он хотел чего-то новенького…

Спустя десять минут, тело парня пронзила неприятная боль, но пилюля мгновенно подавила её, а затем всё начало проходить как по маслу. Боль больше не нарастала, тело Шикамару выделяла прозрачную слизь, и он быстро покрылся ей полностью. Спустя примерно час всё наконец закончилось, он даже не потерял сознание и получение нового Расширенного Генома всё же удалось. Наконец, он получил то, что хотел!

Расширенный Геном (1/1):

— Стихия Металла → 50%

С довольной усмешкой Шикамару кивнул:

— Как и думал, ограничение на один Расширенный геном. Более того… — рассмотрев подробнее инструкцию к этому ограничению, Шикамару мрачно вздохнул: — Эти условия ещё суровей чем при получении родословных. Для получения следующего расширенного Генома нужно достичь двадцати лет, а потом тридцати. Предела как такового нет, но раз в десять лет — это уже слишком много для меня. Благо есть пилюля, но и её цена не то что так просто принять. Более того, использование у простой пилюли всего одно, а затем нужно покупать улучшенную. В общем, я не особо удивлён, но и не сказать, что рад такому исходу… Я присматривался к Геному Энергии и ещё к кое-какому, но теперь…

Прочитав ещё немного инструкции которая только появилась, Шикамару помрачнел ещё больше. Получение Расширенного Генома изменило некоторые системные настройки. Если такие вообще имелись… Шикамару до сих пор не мог понять, как всё работало. Эта система подстраивалась под ситуацию. Хорошо хоть не вредила…

«Значит, теперь ещё и ограничение на Улучшенные Геномы, я тоже этого ожидал, но не так скоро. Благо тут всё куда лучше, одна родословная — один геном. В моё случаю это даже не проблема, я могу себе их позволить» — с хмурым лицом, Шикамару выдохнул и быстро вернул прежнее настроение. Сейчас особо переживать вообще не стоило, так было даже интересней!

К тому же настал момент проверить новую способность, а затем приступить к получению других!

Сосредоточившись, Шикамару задумался:

— В основе металла лежит материя и управление ею, почти как Дотон, поэтому стоит попытаться что-то сотворить при помощи простых вещей… Теперь я столкнулся с проблемой, ведь я не знаю техник моей новой стихии, точно так же как и со Штормом. Ну, стоит попытаться взаимодействовать с тем, что есть… — на этой мысли Шикамару сосредоточился на собственной чакре:

— Изменить массу или структуру, примерно так и работает Дотон. В других же случаях можно придать самой чакре стихийные свойства, как например Техника Каменной Пушки. Тут задействована, как и преобразование стихии так и придание формы, вследствие чего, шиноби просто из чакры создаёт каменную пулю, которая в итоге покидая рот пользователя и увеличивается в размерах. Довольно любопытная техника, мне нужно по этой аналогии сделать что-то подобное. Сомневаюсь, что я смог бы превратить землю в золото, тут нужна чакра… Только вот, хмм… — задумавшись, Шикамару хмуро почесал лоб. По сути, легко сказать, чем сделать, чакру вызвать и преобразовать её силой мысли не получиться, ей нужна команда, особый набор таких команд. Проще говоря, ручные печати. Без них преобразование совершить не получиться, по крайней мере в случае Шикамару, который только получил эту стихию и не владел особым Додзюцу.

«Хмм, если так посмотреть, как-то же люди с Улучшенными Геномами смогли понять… Вот и мне стоит подумать» — с решимостью во взгляде Шикамару вытянул руку вперёд и сосредоточился:

— Давай же… — инстинктивно Шикамару начал осознавать, как преобразовывать чакру в нужной ему пропорции. В тот же момент что-то начало происходить…

Спустя почти сотню попыток что-то преобразовать, Шикамару столкнулся с проблемой, без управления просто направляя чакру слишком сложно придать чакре стихийные свойства.

Ещё через несколько попыток Шикамару начал использовать типичные ручные печати стихии Земли и Огня, в итоге у него начало немного получаться.

Спустя ещё час беспрерывных попыток, Шикамару вытер пот со лба и поднял маленький металлический шарик:

— Неплохо… Я вроде понял принцип. По сути, печати могут быть почти любые, но последовательность определённых быть должна. Некоторые печати лучше взаимодействует с основными пятью природами, это своего рода язык, да и нужно контролировать чакру, тут без них не обойтись… Я инстинктивно понимаю, как взаимодействовать со своим Геномом, но тут нужно будет потрудиться, чтобы сделать что-то эдакое и явно уменьшить ту цепочку что я тут наворотил.

Шикамару выдохнул и стал поочерёдно складывать печати подавая сигнал чакре. Он ещё не определил более логичную последовательность, поэтому печатей было через чур много, он уже знал какие стоит убрать для уменьшения цепочки взаимодействия, но пока что можно было сработать и так. Сложив последнюю — сорок девятую ручную печать Змеи, Шикамару прикоснулся к маленькому камушку и произнёс:

— Изменить! — в тот же момент буквально на глазах благодаря чакре камень преобразился и превратился в серебристо-белый металл точно такой же формы, как и был. Это больше не был простой камень, а настоящий кусок лития, по крайней мере Шикамару считал, что это литий. Структура была очень схожей. Он был довольно лёгкий, да и на вид литий можно различить, всё же он уже имел с ним дело в прошлом.

http://tl.rulate.ru/book/35987/1087314

Расширенный геном Наруто – заявка на фанфик по фэндому Naruto

В общем история начинается во время нападения девятихвостого и смерти Минато, но с изменениями;
1) Кушина остается жива, ее спасает Цунаде с помощью ее техники Бьякуго ( или как-то так, не помню точное название) до пребытия третьего. Ну допустим что именно она принимала роды и джинчурики.
2) Кушина и Цунаде, а также Наруто, дальние родственники ( ну типа седьмая вода на киселе, а если подумать то они и есть родственники ). Эти две женщины сговорились между собой и решили не говорить деревне и ее верхушке, ибо они им не доверяли, что теперь джинчурики является, сын Кушины и Минато. Поэтому к приходу третьего, должна будет остаться одна Кушина, сильно раненая, но живая. И что-бы было все правдоподобно, новоиспечённая мамочка делает поддельную печать у себя на животе, а ребенка прячет Цунаде в лесу слизней, это конечно ненадолго.
3) Когда все утреслось, на очередном осмотре новорожденного Наруто, Цунаде понимает, что у маленького Наруто уникальная чакра, уникальность заключается в том что, ( еще не будучи шиноби, да и вообще, Наруто совсем кроха и не умеет пользоваться чакрой) она может излечить повреждения любой тяжести ( как она узнала придумайте сами ). Принцесса слизней узнав об уникальности мальчика, сразу завалила вопросами Кушину, а та неохотно рассказала, что это особенность клана Намикадзе, и передается по наследству обычно по женской линии( но Наруто мальчик,такое стало возможно из-за чакры Курамы), об этом ей рассказал сам Минато, но они не предполагали что у Наруто будет эта особенность. Рассказав Цунаде, Кушина сразу же поняла, что ее сын находится в еще большей опасности, чем ей показалось сначала, у нее началась небольшая истерика ( ну а вы чего хотели, женщина только после родов, чуть не умерла, оказалась единственной выжившей из джинчурики после извлечения оного, потеря любимого мужа, ребенок роился с улучшенным геномом, к тому же еще и джинчурики). Короче Цунаде, привела ее в порядок, в общем женщины решили скрыть еще и это.
4) Хочется что-бы Саске и Итачи были двойняшками( а как иначе Саске-то девочка, и оставить Итачи старшим, пусть он родится раньше на минуту или даже две). Клан можно уничтожить, но оставить в живых Микото ( мама Саске и Итачи). Микото и Кушина близкие подруги, поэтому Итачи, Саске и Наруто друзья детства. Саске и Наруто не ладят между собой, но в беде друг друга не бросают.
5) Наруто должен знать, что он джинчурики, а также знать уникальность своей чакры( пусть будет так, что на одной из миссий Кушину сильно ранили, конечно ее подлечила Цунаде, но последствия остались, и в один прекрасный момент Кушина сваливается без сознания, а маленький Наруто, сильно испугался за любимую мамочку и не зная что делать, он вдруг вспоминает, как лечит тетя Цунаде. Наруто пытается вылечить маму, вбухивая огромное количество чакры, таким образом он вылечил любимую маму и понял что хочет обучатся у тети Цунаде, как лечить людей, параллельно Наруто учится и у Кушины техникам печатей. Годиков в 6 , мальчик попадает в свое подсознание ( это на усмотрение автора, каким образом ), знакомится с лисом, находит с ним общий язык, будучи еще 7-ми летним ребенком, на одной из тренировок в лесу смерти с Кушиной, Наруто находит умирающию огромную белую тигрицу и сильно раненого тигренка ( ну допустим Кушина отвлеклась на готовку ужина для них или придумайте иную причину), он будучи глубоко убежденным, что всех раненых нужно вылечить, не страшась ранего зверя, сначала вылечивает тигренка, а затем пытается вылечить тигрицу, но у него не хватает чакры, и Наруто заимствует ее и лиса ( иначе говоря входит в режим биджу) вот тут-то появляться Кушина и видит что ее ребенок мало того что обладает лечебной чакрой, так еще будучи в режиме лиса может оживить мертвого(это то и является расширеным геномом Наруто) ( ну во время лечения тигренка, тигрица умирает сама, а Наруто будучи еще ребенком не понял этого). После этого случая Кушина запрещает сыну использовать во время лечения чакру хвостатого, и строго настрого не разрешает говорить о своей способности, кому бы то не было, только Цунаде, уж она-то проверена временем и точно не расскажет об этом не одной живой и даже мертвой душе. ( Как развивать талант воскрешения мертвых решать автору) Все эти события должны быть до поступления Наруто в академию шиноби.
Ну, а дальше все по канону, но Наруто не дурак, и не скрывает способности ниндзя-медика, более того в деревне известно что он ученик Цунаде Сенджу, известно и то что он изучает клановые техники, ведь Кушина жива. Закончив академию, блондин попадает в команду с Учихой Саске ( помним, что Саске девочка) Юки Хаку ( или можете добавить своего персонажа), а наставником будет Джирайя. Хочу что-бы Наруто носил разные кимоно и очки, а то надоел уже его оранжевый комбинезон. Миссии можно канонные, а можно и свои ( разнообразие приветствуется). Так как Наруто мальчик умный ( все благодаря воспитанию Кушины и даже Цунаде приложила свою руку ), то он довольно таки популярен среди девочек ( пожалуйста без фанатизма девочек ).
Пейринг обязательно Наруто/ фем Саске, развивайте пж отношения между этими двумя грамотно, никаких резких влюбленностей после спасения и так далее. По поводу Итачи решайте сами, я только хочу что-бы его характер не сильно отличался от каноннго т.е он добрый гениальный мальчик, но закончивший академию вместе с младшей сестрой и гоняющий всех поклонников от любимой сестренки, исключение Наруто т.к они друзья детсва. Вроде бы все, если есть вопросы задавайте в комах и личку. БЕЗ ЯОЯ, ЮРИ и НЕЦЕНЗУРЩИНЫ.

Часть 2.Первый расширенный геном., Наруто Ооцуцуки — фанфик по фэндому «Naruto»

Часть 2.Первый расширенный геном.

5 октября 2020, 11:17

Прошло 4 года.
      По улице Конохи шел мальчик 4 лет с белыми волосами и того же цвета глазами,люди видевшие его относились к нему с презрением и даже отвращением ведь старейшины не смогли сохранить в тайне то кем является джинчурики Кьюби. Наруто жил в приюте его недолюбливали ,плохо кормили ,а 10 октября как и сегодня выгоняли его из приюта чтобы тот не мешал им праздновать победы над демоном.Наш герой был умным мальчиком,он развивался быстрее многих детей приюта,но этого никто не замечал и мальчик решил не выделятся,единственный кто знал что Наруто умеет читать и писать это библиотекарь Конохи ведь именно он и обучил мальчика не понимаю почему люди ненавидят сосуд сдерживающий биджу.
      Вернемся к Наруто,он направлялся в библиотеку чтобы отсидеться в этот злополучный день там.Но его планам не суждено было сбыться спустя пару поворотов он наткнулся на группу гражданских и нескольких чунинов.
Неизвестный-Ой смотрите это же демон давайте проучим его ,чтобы он не портил праздник хорошим людям-сказал он.
Чунин-Согласен его нужно проучить.
      Тут в Наруто начали лететь камни и другие предметы бросаемые гражданскими и поэтому он не заметил как к нему подошел чунин и ударом ноги в бок откинул джинчурики на пару метров.Наруто упал и харкнул кровью, но жителям этого было мало и они стали бить Узумаки подручными предметами.Спустя пару минут Наруто был весь избит и получил пару переломов после чего чунин взял его за шкирку и поднес в центр толпы.
Чунин-Кто хочет чтобы я сейчас убил этого демона?-крикнул он на всю площадь.
      Его поддержал нестройный гул согласия со стороны жителей. Чунин вынул кунай из подсумка и когда уже он собирался вонзить его в тело ребенка кунай остановился, уперевшись во что то невидимой и вот в мгновенье кунай вырвался из рук чунина и улетел в сторону а все металлические вещи в округе стали дрожать.В тоже мгновенье на площади появились несколько АНБУ корня повалив чунина и схватив его.Через пару минут на площадь вышел сам глава Корня Шимура Данзо.
Данзо-Что здесь происходит?-его голос эхом разнесся по площади.
Чунин-Данзо-сама мы всего лишь хотели избавить нашу деревню от этого демона!-сказал схваченный чунин и уже хотел плюнуть в джинчурики ,но был остановлен ударом в живот резко появившимся перед ним Данзо.
Данзо-И куда только смотрит АНБУ приставленные хокаге?Тензо отведи это-он кивнул на чунина-к Ибики он больше не ниндзя скрытого листа и пойдет под трибунал за измену деревне.А теперь слушайте вы все я один из Старейшин Конохи Шимура Данзо запрещаю жителям нападать на этого мальчика иначе их схватят АНБУ и они пойдут под суд.-Данзо специально не стал говорить что это будут его АНБУ чтобы не раскрыть Корень.
      После этих слов горожане перешептываясь стали расходиться а один из АНБУ взяв на руки мальчика растворился в Шуншине в след за ним пропал и Данзо.
Появились они на базе Корня и сразу направились в медблок там их встретил высокий мужчина с длинными черными волосами,бледной кожей и со змеиными глазами,это был один из трех легендарных Санинов Орочимару.
Орочимару-Здравствуйте Данзо-сан,кто это тут у вас?-с нотками шипения спросил Орочимару подходя к вошедшим и разглядывая мальчика на руках АНБУ.
Данзо-Орочимару это Наруто он джинчурики Кьюби и на него было совершенно нападение жителями ,он ранен и ему нужна твоя помощь-сообщил он Орочимару.
Орочимару без слов взял мальчика и положил на одну из кушеток.Орочимару поднес руки к телу мальчика и когда те засветились зеленым светом стал водить ими вдоль тела Наруто.Спустя пару минут санин нахмурился и стал лечить раны.
Орочимару-Если бы не его регенерация неизвестного происхождения он бы был уже мертв , а так я еще могу ему помочь.-Сообщил Орочимару и больше не отвлекаясь продолжил лечение.
      Данзо сжал кулаки если бы не он и его люди джинчурики , тот в кого поверил его друг могу погибнуть.Данзо стал размышлять о том как помочь мальчику и пришел к выводу что можно уговорить хокаге отдать Наруто в корень и с этими мыслями Данзо ушел,а АНБУ отправился на патрулирование.
Утро следующего дня.
Pov.Наруто.
      Последнее что я помню это как на меня напали жители деревни потом удар и темнота.Но вот я очнулся и почувствовал запах медикаментов и открыв глаза увидел белый потолок.Вдруг я услышал преближающиеся шаги и прикрыл глаза.
Неизвестный-Хм мальчишка еще не очнулся.-сказал голос с шипящими нотками.
      Спустя пару минут тишины любопытсво победило и я открыл глаза.Не далеко от себя он увидел странного мужчину, но когда он заглянул ему в глаза то испугался,металлические предметы в комнате стали взлетать и окружать меня словно щит.
End Pov.Наруто.
      Как только Орочимару хотел разбудить мальчишку он встретился с ним взглядом и вот он увидел в его глазах испуг и тут же мальчика окружили металлические предметы находящиеся в лаборатории.
Орочимару-Успакойся Наруто-кун ,меня зовут Орочимару и я не причиню тебе вред.-сказал Орочимару внутри удивляясь тому что у джинчурики оказался геном Третьего казекаге Джитон-стизия магнетизма.
      Наруто сам не понял почему но ему захотелось доверится этому человеку и вот предметы стали падать на землю а джинчурики вдруг потерял сознание.
      Как только Наруто отключился Орочимару подбежал к нему и стал проверять его здоровья,убедившись что все в норме он отправился сообщить Данзо о том что ребенок в порядке и о том что у него есть кекей генкай.
Продолжение следует…

Сдать анализ на гены системы гемостаза (с описанием результатов врачом- генетиком)

Метод определения
Real-time-PCR.

Исследуемый материал
Цельная кровь (с ЭДТА)

Доступен выезд на дом

Расширенное исследование генов системы гемостаза: F2, F5, MTHFR, MTR, MTRR, F13, FGB, ITGA2, ITGВ3, F7, PAI-1

Комплексное исследование генетических факторов риска развития нарушений в системе свертывания крови и фолатном цикле.

 

Различные изменения в генах системы гемостаза и цикла обмена фолатов предрасполагают к развитию большого числа патологических состояний: инфаркты, инсульты, тромбоэмболии, кровотечения, патология беременности и родов, осложнения послеоперационного периода и т.д. 

Профиль включает в себя исследование основных полиморфизмов в генах системы гемостаза и фолатного цикла: 

  1. F2 c.*97G>A (20210 G>A; rs1799963),
  2. F5 c.1601G>A (Arg534Gln; 1691 G>A; rs6025),  
  3. MTHFR c.665C>T (Ala222Val; 677 C>T; rs1801133), 
  4. MTHFR c.1286A>C (Glu429Ala; 1298 A>C; rs1801131), 
  5. MTR c.2756A>G (Asp919Gly; rs1805087), 
  6. MTRR c.66A>G (Ile22Met; rs1801394), 
  7. F13 с.103G>T (I63Т; rs5985), 
  8. FGB c.-467G>A (-455 G>А; rs1800790), 
  9. ITGA2 c.759C>T (Phe253Phe, 807 C>T; rs1126643), 
  10. ITGB3 c.176T>C (Leu59Pro; 1565 T>C; rs5918), 
  11. F7 c.1238G>A (Arg353Gln; 10976 G>A; rs6046), 
  12. PAI-1 (SERPINE1) –675 5G>4G (rs1799889). 

Ген F2 кодирует аминокислотную последовательность белка протромбина. Полиморфизм F2 c.*97G>A приводит к повышенной экспрессии гена. Клинически неблагоприятный вариант полиморфизма (c.*97A) наследуется по аутосомно-доминантному типу. Наличие полиморфизма F2 c.*97G>A в гомозиготной или гетерозиготной форме значительно (в 3 и более раз, а на фоне курения — в 40 и более раз) увеличивает риск возникновения венозных тромбозов, в том числе тромбозов сосудов мозга и сердца, особенно в молодом возрасте. У пациентов-носителей данного полиморфизма повышен риск развития тромбоэмболий после хирургических вмешательств. Приём оральных контрацептивов у данной группы лиц также увеличивает риск тромбозов (относительный риск развития тромбофилии и венозной тромбоэмболии у гетерозиготных носительниц полиморфизма c.*97G>A возрастает в 16 раз).

Ген F5 кодирует аминокислотную последовательность белка проакцелерина — коагуляционного фактора 5. Нуклеотидная замена c.1601G>A («мутация Лейден») приводит к аминокислотной замене аргинина на глутамин в позиции 534, что придает устойчивость активной форме проакцелерина. Клинически это проявляется рецидивирующими венозными тромбозами и тромбоэмболиями. Наличие полиморфизма в гомозиготной или гетерозиготной форме значительно (в 3 и более раз, а на фоне заместительной гормонотерапии или приема оральных контрацептивов — в 30 и более раз) увеличивает риск венозных тромбозов. Риск инфаркта миокарда увеличивается в 2 и более раз, риск развития патологии беременности (прерывание беременности, преэклампсия, хроническая плацентарная недостаточность и синдром задержки роста плода) увеличивается в 3 и более раз. 

Также, пациенты, являющиеся одновременно носителями полиморфизма c.*97G>A гена протромбина и «мутации Лейден», еще в большей степени подвержены риску развития тромбозов и тромбоэмболий.

 

Ген MTHFR кодирует аминокислотную последовательность фермента метилентетрагидрофолатредуктазы, играющего ключевую роль в метаболизме фолиевой кислоты. Полиморфизм c.665C>T гена MTHFR связан с заменой нуклеотида цитозина (С) на тимин (Т), что приводит к аминокислотной замене аланина на валин в позиции 222. Вариант c.665Т связан с четырьмя группами мультифакториальных заболеваний: сердечно-сосудистыми, дефектами развития плода, колоректальной аденомой и раком молочной железы и яичников. У женщин с генотипом c.665Т/Т дефицит фолиевой кислоты во время беременности может приводить к порокам развития плода, в том числе незаращению нервной трубки. Неблагоприятное воздействие варианта c.665Т- зависит от внешних факторов: низкого содержания в пище фолатов, курения, приема алкоголя. Сочетание генотипа c.665Т/Т и папилломавирусной инфекции увеличивает риск цервикальной дисплазии. Назначение препаратов фолиевой кислоты может значительно снизить негативное влияние данного варианта полиморфизма. 

Полиморфизм MTHFR c.1286A>C связан с точечной заменой нуклеотида аденина (А) на цитозин (С), что приводит к замене аминокислотного остатка глутаминовой кислоты на аланин в позиции 429, относящейся к регулирующей области молекулы фермента. При наличии данного полиморфизма отмечается снижение активности фермента MTHFR. Это снижение обычно не сопровождается изменением уровня гомоцистеина в плазме крови у носителей дикого варианта полиморфизма c.665C>T, однако сочетание аллельного варианта* c.1286C с аллелем c.665T приводит к снижению уровня фолиевой кислоты и соответствует по своему эффекту гомозиготному состоянию MTHFR c.665Т/T. При этом риск развития дефектов нервной трубки повышается в 2 раза. Жизнеспособность плодов, имеющих одновременно оба полиморфных варианта, также снижена.

 

Ген MTR кодирует аминокислотную последовательность фермента метионин синтазы. Полиморфизм c.2756A>G связан с аминокислотной заменой (аспарагиновой кислоты на глицин) в молекуле фермента. В результате этой замены функциональная активность фермента изменяется, что приводит к повышению риска формирования пороков развития у плода. Влияние полиморфизма усугубляется повышенным уровнем гомоцистеина. 

Ген MTRR кодирует аминокислотную последовательность фермента редуктазы метионинсинтазы. Полиморфизм c.66A>G связан с аминокислотной заменой в молекуле фермента. В результате этой замены функциональная активность фермента снижается, что приводит к повышению риска развития дефектов нервной трубки у плода. Влияние полиморфизма усугубляется дефицитом витамина В12. При сочетании полиморфизма c.66A>G гена MTRR с полиморфизмом c.665C>T в гене MTHFR риск spina bifida увеличивается. Полиморфизм c.66A>G гена MTRR усиливает гипергомоцистеинемию, вызываемую полиморфизмом c.665C>T в гене MTHFR. 

Ген фибриназы (F13) кодирует синтез трансглютаминазы, участвующей в стабилизации фибринового сгустка и в формировании соединительной ткани. Аллельные варианты с.103G/Т и с.103Т/Т приводят к снижению уровня трансглютаминазы с образованием сетчатой структуры фибрина с более тонкими волокнами, меньшими порами, и изменением характеристик проникновения, которое в сочетании с другими факторами риска ассоциируется с возможным риском внутричерепных кровоизлияний и кровотечений из внутренних органов, а также привычным невынашиванием беременности. При этом аллельный вариант с.103Т может выступать в роли протективного фактора в отношении инфаркта миокарда и венозных тромбозов.

Ген FGB кодирует β-цепь фибриногена, являющегося предшественником фибрина. Аллельный вариант c.-467А обусловливает усиленную транскрипцию гена и может приводить к увеличению уровня фибриногена в крови и повышению вероятности образования тромбов при наличии дополнительных факторов риска. Гетерозиготный вариант c.-467G/А связывают с повышенным риском ишемического инсульта и лакунарными инфарктами церебральных сосудов. Гомозиготный вариант c.-467A/А связывают с повышенным риском инфаркта миокарда. 

Ген гликопротеина Gp1a (ITGA2) кодирует синтез альфа-2-субъединицы интегринов – специализированных рецепторов тромбоцитов. Аллельный вариант c.759Т вызывает изменение первичной структуры субъединицы и свойств рецепторов. При гетерозиготном (c.759C/T) варианте отмечается увеличение скорости адгезии тромбоцитов к коллагену I типа, что может приводить к повышенному риску тромбофилии, инфаркта миокарда и других сердечно-сосудистых заболеваний. Аллельный вариант c.759Т связывают со случаями резистентности к аспирину. Помимо этого, при гомозиготном (c.759Т/T) варианте значительно увеличивается количество рецепторов на поверхности тромбоцитов. В совокупности, при гомозиготном варианте данного полиморфизма значительно повышен риск тромбофилии, инфаркта миокарда и развития других острых эпизодов тромбообразования в возрасте до 50 лет, даже по сравнению с гетерозиготным вариантом. 

Ген гликопротеина Gp3a (ITGB3) кодирует синтез бета-3 цепи интегринового комплекса GP2b\3a, участвующего в разнообразных межклеточных взаимодействиях (адгезии и сигнализации). 

Аллельный вариант c.176С (гетерозигота c.176T/C) обусловливает повышенную адгезию тромбоцитов и может приводить к увеличению риска развития острого коронарного синдрома, а также связан с синдромом привычного невынашивания беременности. Гомозиготный вариант c.176С/C обусловливает повышенную адгезию тромбоцитов и может приводить к значительному увеличению риска развития острого коронарного синдрома в возрасте до 50 лет. У лиц с полиморфными аллельными вариантами часто отмечается пониженная эффективность аспирина. 

Аллельный вариант c.1238A (гетерозигота c.1238G/A и гомозигота c.1238А/A) гена F7 приводит к понижению экспрессии гена и снижению уровня фактора 7 в крови, рассматривается как протективный маркёр в отношении развития тромбозов и инфаркта миокарда. 

Ген ингибитора активатора плазминогена (PAI-1) кодирует белок-антагонист тканевого и урокиназного активатора плазминогена. Преобладающим в популяции вариантом исследуемого полиморфизма является гетерозиготный вариант -675 5G/4G. В связи с этим данный полиморфизм самостоятельного диагностического значения не имеет, эффект возможно оценить в сочетании с другими факторами предрасполагающими к развитию патологии (например в сочетании с FGB c.-467A). Аллельный вариант -675 4G сопровождается большей активностью гена, чем -675 5G, что обусловливает более высокую концентрацию PAI-1 и уменьшение активности противосвёртывающей системы. Гомозигота -675 4G/4G ассоциирована с повышением риска тромбообразования, преэклампсии, нарушением функции плаценты и самопроизвольного прерывания беременности.

*Примечание: иногда в научной литературе при описании однонуклеотидных замен, характерных для генных полиморфизмов, встречается термин «мутантный аллель». Это терминологическая неточность, так как в классической генетике термин «мутантный аллель» традиционно рассматривается как синоним термина «мутация». При мутациях, как известно, изменение структуры гена приводит к образованию (экспрессии) нефункциональных белков и к неизбежному развитию наследственного заболевания. При полиморфизмах изменение в структуре гена приводит лишь к появлению белков с немного изменёнными физико-химическими свойствами. Такие изменения, как известно, проявляют себя при воздействии на организм различных факторов внешней среды или при изменении функционального состояния организма человека. И только в таких ситуациях функционирование белков со структурными особенностями может, либо способствовать ускорению развития заболевания, либо, напротив, тормозить формирование патологических процессов. Поэтому, на наш взгляд, для разграничения изменений в генах столь очень похожих структурно, но приводящих к несоизмеримо разным последствиям для организма, корректнее в отношении генных полиморфизмов применять понятие «аллельный вариант гена», а не «мутантный аллель».

Медицинский центр — Асклепий в г. Находка Хромосомный микроматричный анализ пренатальный стандартный***. Сдать анализ во Владивостоке. Стоимость: 30500руб.

Исследуемый материал: 1.амниотическая жидкость (не менее 3 мл в специальные стерильные пробирки)
2.ворсины хориона (10-20 мг, в стерильные пробирки с 0,9% раствором NaCl)
3.пуповинная кровь (не менее 1,5 мл в пробирку с ЭДТА)

Сроки исполнения: 10 р.д.

Подготовка к исследованию:
Специальной подготовки к исследованию не требуется.
При себе иметь направление или выписки/заключения от врачей.

Об исследовании:
СТАНДАРТНЫЙ ХРОМОСОМНЫЙ МИКРОМАТРИЧНЫЙ АНАЛИЗ Пренатальный(молекулярное кариотипирование) – проводится на микроматрице средней плотности которая содержит 750 тыс. маркеров с высокой плотностью покрывающих все клинически значимые участки генома. Разрешающая способность стандартного ХМА от 200 000 п.н. (в отдельных регионах от 50 000 п.н.) Технология олигонуклеотидного микроматричного анализа позволяет добиться высокой точности при выявлении перестроек не видимых в обычный микроскоп. Преимуществом является отсутствие ложных результатов и скорость выполнения исследования.
При выполнении этого анализа с максимальной точностью исследуются все клинически значимые участки генома. Это позволяет выявить большое число хромосомных нарушений на ранних сроках беременности, в том числе практически все известные на сегодняшний день микроделеционные и микродупликационные синдромы и участки с потерей гетерозиготности, которые могут быть признаками однородительских дисомий, связанных с болезнями импринтинга. Известные генетические заболевания, выявляемые хромосомным микроматричным анализом, включают состояния, характеризующиеся умственной отсталостью, такие как синдром Ангельмана, синдром Вольфа-Хиршхорна, синдром Вильямса и другие. Данный тест также способен выявить различные делеции и дупликации в субтеломерных участках хромосом, являющиеся важными причинами многих синдромов с задержкой развития. Метод полностью заменяет кариотип и дает возможность определить контаминацию образца материнским материалом, что исключает риск ложноотрицательных результатов.
По результатам стандартного хромосомного микроматричного анализа выдается заключение врача-генетика.
Для кого:Обследование может пройти пара (муж, жена) с репродуктивными неудачами, отдельно муж или жена, родившийся ребенок.

Посмотреть ещё

ВОЗ опубликовала рекомендации по редактированию генома человека 

Публикация докладов стала результатом многосторонних глобальных консультаций, посвященных редактированию генома человека. В работе, продолжавшейся более двух лет, принимали участие сотни ученых и исследователей, религиозные, политические и общественные лидеры, а также представители коренных народов разных стран. 

«Редактирование генома человека может значительно повысить наши возможности по лечению многих опасных заболеваний, – сказал Генеральный директор ВОЗ Тедрос Гебрейесус. –  Однако в полной мере эту технологию можно будет реализовать лишь в том случае, если она будет направлена на благо всех людей, а не усугубит неравенство». 

Потенциальные преимущества редактирования генома человека заключаются в возможности более быстрой и точной диагностики, а также эффективного лечения и профилактики генетических нарушений. Соматическая генная терапия, позволяющая изменять ДНК пациента, ранее успешно использовалась для лечения ВИЧ и других серьезных заболеваний. 

В перспективе этот революционный метод также может значительно улучшить эффективность лечения различных видов рака. Однако при этом сохраняются определенные риски –  генетические изменения могут передаваться последующим поколениям, модифицируя физиологические особенности потомков. 

«Доклады Консультативного комитета экспертов ВОЗ –  это прорыв в такой быстро развивающейся области науки, как генная инженерия, –  сказала Главный научный сотрудник ВОЗ д-р Сумия Сваминатан. –  По мере того, как ученые смело продвигаются в процессе изучения генома человека, нам необходимо минимизировать риски и определить рычаги, с помощью которых наука сможет улучшить здоровье людей во всех уголках планеты». 
 
В ближайшее время ВОЗ собирается созвать комитет экспертов для разработки следующих шагов в направлении безопасной генной инженерии, а также более жесткого контроля за клиническими испытаниями тех генных технологий, которые пока еще вызывают озабоченность у общественности.

Кроме того, ВОЗ планирует собрать заинтересованные стороны из различных сфер науки и медицины для разработки доступного механизма конфиденциального предупреждения о незаконных, незарегистрированных, неэтичных или небезопасных исследованиях по редактированию генома человека. 
 

Расширенные геномы: симбиоз и эволюция

Многие аспекты биологии человека проистекают из его взаимодействия с симбиотическими микробами, что дополнительно определяет многие аспекты экологии и эволюции видов-хозяев. Центральная роль микробов в функциях отдельных организмов привела к появлению концепции холобионта — что биология человека лучше всего понимается как совокупность «организма-хозяина» и симбионтов внутри.Эта концепция была доработана, чтобы постулировать холобионт как единицу отбора. В этом обзоре я критически исследую, полезно ли рассматривать холобионтов как единицу отбора. Я утверждаю, что микробная наследственность — прямой переход микробов от родителей к потомству — является ключевым фактором, определяющим степень, в которой холобионт может считаться уровнем отбора. Там, где обычна прямая вертикальная передача (VT), микробы являются частью расширенных геномов, динамику которых можно смоделировать с помощью простой популяционной генетики, но которые, тем не менее, имеют тонкие количественные отличия от классической модели мутации / отбора для ядерных генов.Без прямой ЖТ корреляция между приспособленностью микробов и индивидуальной приспособленностью хозяина разрушается, и приспособленность микробов становится связанной только с выживанием хозяина (а не с размножением). Кроме того, круговорот микробов внутри хозяина может уменьшать связь между приспособленностью микробов и выживанием хозяина, а в полимикробных сообществах приспособленность микробов может в значительной степени определяться способностью побеждать другие микробы, избегать иммунного выведения из организма хозяина и минимизировать смертность от фаговой инфекции.Эти конкурирующие давления отбора делают приспособленность холобионта очень второстепенным фактором при определении эволюции симбионта. Тем не менее, важность ненаследственных микробов для функционирования организма не вызывает сомнений, и поэтому эволюционные и экологические процессы, приводящие к изменению и эволюции микробов внутри и между индивидуумами-хозяевами, представляют собой ключевую область исследований в биологии.


Ключевые слова:

расширенный эволюционный синтез; наследственность; симбиоз.

Длинночитываемое секвенирование генома человека и его приложения

  • 1.

    ван Дейк, Э. Л., Ящишин, Ю., Накин, Д. и Термес, К. Третья революция в технологии секвенирования. Trends Genet. 34 , 666–681 (2018).

    PubMed

    Google ученый

  • 2.

    Shendure, J. et al. Секвенирование ДНК в 40 лет: прошлое, настоящее и будущее. Природа 550 , 345–353 (2017).

    CAS
    Статья

    Google ученый

  • 3.

    Sudmant, P.H. et al. Интегрированная карта структурных вариаций в 2 504 геномах человека. Природа 526 , 75–81 (2015).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 4.

    Sudmant, P.H. et al. Глобальное разнообразие, стратификация населения и выбор вариации числа копий человека. Наука 349 , aab3761 (2015).

    PubMed
    PubMed Central

    Google ученый

  • 5.

    Ng, S. B. et al. Секвенирование экзома определяет мутации MLL2 как причину синдрома Кабуки. Nat. Genet. 42 , 790–793 (2010).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 6.

    Kircher, M. et al. Общая схема оценки относительной патогенности генетических вариантов человека. Nat. Genet. 46 , 310–315 (2014).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 7.

    Simonson, T. S. et al. Генетические доказательства высотной адаптации в Тибете. Наука 329 , 72–75 (2010).

    CAS
    PubMed

    Google ученый

  • 8.

    Sudmant, P.H. et al. Разнообразие вариаций числа копий человека и многокопийность генов. Наука 330 , 641–646 (2010).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 9.

    Chaisson, M. J. P. et al. Мультиплатформенное открытие структурных вариаций в геномах человека с разрешенными гаплотипами. Nat. Commun. 10 , 1784 (2019). В этом исследовании сравниваются множественные последовательности и технологии картирования для геномов трех троек родитель-ребенок и количественно определяется количество отсутствующих генетических вариаций. Разработан метод Phased-SV, который разделяет долго считываемые данные на основе поэтапных однонуклеотидных полиморфизмов, который разрешает последовательность обоих структурных гаплотипов .

    PubMed
    PubMed Central

    Google ученый

  • 10.

    Консорциум проекта «1000 геномов». и другие. Глобальный справочник по генетической изменчивости человека. Природа 526 , 68–74 (2015).

    Google ученый

  • 11.

    Бейли, Дж. А., Явор, А. М., Масса, Х. Ф., Траск, Б. Дж. И Эйхлер, Е. Е. Сегментарные дупликации: организация и влияние в рамках текущей сборки проекта генома человека. Genome Res. 11 , 1005–1017 (2001).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 12.

    Ходжкинсон А., Чен Ю. и Эйр-Уокер А. Крупномасштабное распределение соматических мутаций в геномах рака. Гум. Мутат. 33 , 136–143 (2012).

    CAS
    PubMed

    Google ученый

  • 13.

    Хиллз, М., Джеяпалан, Дж. Н., Фоксон, Дж. Л. и Ройл, Н. Дж. Механизмы мутации, которые лежат в основе обновления соседнего с теломерами сегментарного дупликации человека, содержащего нестабильный минисателлит. Genomics 89 , 480–489 ​​(2007).

    CAS
    PubMed

    Google ученый

  • 14.

    Гастингс, П. Дж., Лупски, Дж. Р., Розенберг, С. М. и Ира, Г. Механизмы изменения числа копий гена. Nat. Преподобный Жене. 10 , 551–564 (2009).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 15.

    Zheng, G. X. Y. et al. Гаплотипирование геномов зародышевой линии и рака с помощью высокопроизводительного секвенирования с последовательным считыванием. Nat. Biotechnol. 34 , 303–311 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 16.

    Zhang, F. et al. Фазирование гаплотипа всего генома человека с использованием разбиения штрих-кода на основе шариков в одной пробирке. Nat. Biotechnol. 35 , 852–857 (2017).

    CAS
    PubMed

    Google ученый

  • 17.

    Wang, O. et al. Эффективное и уникальное кобар-кодирование считываний секвенирования второго поколения с длинных молекул ДНК, обеспечивающее экономичное и точное секвенирование, гаплотипирование и сборку de novo. Genome Res. 29 , 798–808 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 18.

    Li, R. et al. Синтетическое секвенирование с длинным считыванием Illumina позволяет восстанавливать недостающие последовательности даже в «законченном» геноме C. elegans . Sci. Отчетность 5 , 10814 (2015).

    Google ученый

  • 19.

    Peters, B.A. et al. Точное секвенирование всего генома и гаплотипирование от 10 до 20 клеток человека. Природа 487 , 190–195 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 20.

    Lieberman-Aiden, E. et al. Комплексное картирование дальнодействующих взаимодействий раскрывает принципы складывания генома человека. Наука 326 , 289–293 (2009).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 21.

    Ghurye, J. et al. Интеграция ссылок Hi-C с графами сборки для сборки в масштабе хромосомы. PLoS Comput. Биол. 15 , e1007273 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 22.

    Garg, S. et al. Эффективная сборка геномов человека с разрешением по гаплотипам в масштабе хромосом. Препринт на bioRxiv https://doi.org/10.1101/810341 (2019).

    Артикул

    Google ученый

  • 23.

    Harewood, L. et al. Hi-C как инструмент для точного обнаружения и характеристики хромосомных перестроек и вариаций числа копий в опухолях человека. Genome Biol. 18 , 125 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 24.

    Чу, Дж., Мохамади, Х., Уоррен, Р. Л., Янг, К. и Бирол, И. Инновации и проблемы в обнаружении перекрытий при длительном чтении: оценка современного состояния. Биоинформатика 33 , 1261–1270 (2017).

    CAS
    PubMed

    Google ученый

  • 25.

    Юнг, Х., Вайнфилд, К., Бомбарели, А., Прентис, П. и Уотерхаус, П. Инструменты и стратегии для долгого секвенирования и сборки de novo геномов растений. Trends Plant Sci. 24 , 700–724 (2019).

    CAS
    PubMed

    Google ученый

  • 26.

    Седлазек, Ф. Дж., Ли, Х., Дарби, К. А. и Шатц, М. С. Проникновение в темную материю: биоинформатика секвенирования и картирования на больших расстояниях. Nat. Преподобный Жене. 19 , 329–346 (2018).

    CAS
    PubMed

    Google ученый

  • 27.

    Шассон, М.Дж. П., Уилсон, Р. К. и Эйхлер, Е. Е. Генетические вариации и сборка de novo геномов человека. Nat. Преподобный Жене. 16 , 627–640 (2015).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 28.

    Поллард, М. О., Гурдасани, Д., Ментцер, А. Дж., Портер, Т. и Сандху, М. С. Лонг читает: их цель и место. Гум. Мол. Genet. 27 , R234 – R241 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 29.

    Мантере Т., Керстен С. и Хойшен А. Долговременное секвенирование, появляющееся в медицинской генетике. Фронт. Genet . 10 , 426 (2019).

  • 30.

    Kronenberg, Z. N. et al. Сравнительный анализ геномов человекообразных обезьян в высоком разрешении. Наука 360 , eaar6343 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 31.

    Audano, P.A. et al. Характеристика основных структурных вариантов аллелей генома человека. Ячейка 176 , 663–675.e19 (2019). В этой статье представлен большой каталог структурных вариантов с разрешенной последовательностью, основанный на анализе последовательностей с длительным считыванием разнообразной панели из 15 геномов, и определены случаи, когда человеческий эталон имеет минорный аллель для структурного варианта. Он также разрабатывает основанный на машинном обучении подход для генотипирования структурных вариантов с разрешенной последовательностью в данных последовательности полногеномного ружья Illumina, что привело к открытию локусов количественных признаков экспрессии и новых ведущих вариантов для полногеномных ассоциативных исследований .

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 32.

    Huddleston, J. et al. Обнаружение и генотипирование структурных вариаций на основе данных длинночитаемых последовательностей гаплоидного генома. Genome Res. 27 , 677–685 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 33.

    Chaisson, M. J. P. et al. Разрешение сложности генома человека с помощью секвенирования одной молекулы. Природа 517 , 608–611 (2015). В этой статье описывается один из первых методов упорядочивания и сборки структурных вариаций на основе данных длинночитаемых последовательностей. Это показывает, что большинство из этих вариантов являются новыми, и, таким образом, большая часть генетических вариаций человека упускается из виду с помощью подходов короткого считывания секвенирования.

    CAS
    PubMed

    Google ученый

  • 34.

    Miga, K. H. et al. Сборка теломер-теломер полной Х-хромосомы человека.Препринт на bioRxiv https://doi.org/10.1101/735928 (2019). Это знаменательное исследование показывает, что длинные чтения PacBio и ONT способны генерировать сборку генома de novo, превосходящую по смежности все другие сборки генома (включая hg38). Важно отметить, что это выявляет первую сборку последовательности теломер-теломер хромосомы человека и показывает, что можно разрешить массивы почти идентичных тандемных повторов (то есть центромеры) размером с мегабазу с помощью длинных и сверхдлинных считываний .

    Артикул

    Google ученый

  • 35.

    Jain, M. et al. Секвенирование нанопор и сборка генома человека со сверхдлинными считываниями. Nat. Biotechnol. 36 , 338–345 (2018). В этой статье показано, что сверхдлинные чтения ONT можно использовать для сборки генома человека de novo. Кроме того, эта сборка впервые разрешила оба гаплотипа главного локуса гистосовместимости человека .

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 36.

    Shafin, K. et al. Секвенирование нанопор и инструментарий Shasta обеспечивают эффективную сборку de novo одиннадцати геномов человека. Nat. Biotechnol. https://doi.org/10.1038/s41587-020-0503-6 (2020). В этом исследовании описывается быстрая сборка 11 геномов человека с использованием длинных считываний ONT и дебютирует новый ассемблер (Shasta) и полировщик (HELEN). В этой статье представлена ​​методологическая основа масштабируемости сборки генома человека с использованием длинных считываний .

    Артикул
    PubMed
    PubMed Central

    Google ученый

  • 37.

    Payne, A., Holmes, N., Rakyan, V. & Loose, M. BulkVis: графический просмотрщик файлов Oxford Nanopore bulk FAST5. Биоинформатика 35 , 2193–2198 (2019).

    CAS
    PubMed

    Google ученый

  • 38.

    Рэнг, Ф. Дж., Клоостерман, У. П. и де Риддер, Дж. От волнистости к базовой паре: вычислительные подходы для повышения точности считывания секвенирования нанопор. Genome Biol. 19 , 90 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 39.

    Ardui, S., Ameur, A., Vermeesch, J. R. & Hestand, M. S. Секвенирование одиночных молекул в реальном времени (SMRT) достигло совершеннолетия: приложения и утилиты для медицинской диагностики. Nucleic Acids Res. 46 , 2159–2168 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 40.

    Карнейро, М.O. et al. Технология секвенирования Pacific Biosciences для генотипирования и обнаружения вариаций в человеческих данных. BMC Genomics 13 , 375 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 41.

    Eid, J. et al. Секвенирование ДНК в реальном времени по отдельным молекулам полимеразы. Наука 323 , 133–138 (2009).

    CAS
    PubMed

    Google ученый

  • 42.

    Корлах, Дж. Понимание точности секвенирования SMRT®. PacBio https://www.pacb.com/wp-content/uploads/2015/09/Perspective_UnderstandingAccuracySMRTSequencing.pdf (2015).

  • 43.

    Роадс, А. и Ау, К. Ф. Секвенирование PacBio и его приложения. Геномика Протеомика Биоинформатика 13 , 278–289 (2015).

    PubMed
    PubMed Central

    Google ученый

  • 44.

    Weirather, J.L. et al. Всестороннее сравнение Pacific Biosciences и Oxford Nanopore Technologies и их приложений для анализа транскриптомов. F1000Res 6 , 100 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 45.

    Фокс, Э. Дж., Рид-Бейлисс, К. С., Эмонд, М. Дж. И Лоеб, Л. А. Точность платформ секвенирования нового поколения. Следующее поколение. Seq. Прил. 1 , 1000106 (2014).

    PubMed
    PubMed Central

    Google ученый

  • 46.

    Chin, C.-S. и другие. Негибридные, готовые сборки микробного генома на основе данных секвенирования SMRT с длительным считыванием. Nat. Методы 10 , 563–569 (2013).

    CAS
    PubMed

    Google ученый

  • 47.

    Walker, B.J. et al. Pilon: интегрированный инструмент для комплексного обнаружения вариантов микробов и улучшения сборки генома. PLoS One 9 , e112963 (2014).

    PubMed
    PubMed Central

    Google ученый

  • 48.

    Васер, Р., Сович, И., Нагараджан, Н. и Шикич, М. Быстрая и точная сборка генома de novo из длинных неисправленных считываний. Genome Res. 27 , 737–746 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 49.

    Гарнизон, Э.И Март, Г. Обнаружение вариантов на основе гаплотипов с помощью короткого секвенирования. Препринт на arXiv https://arxiv.org/abs/1207.3907 (2012).

  • 50.

    Gordon, D. et al. Сборка длинночитаемых последовательностей генома гориллы. Наука 352 , aae0344 (2016).

    PubMed
    PubMed Central

    Google ученый

  • 51.

    Ху, Дж., Фан, Дж., Сан, З. и Лю, С. NextPolish: быстрый и эффективный инструмент для полировки генома для сборки длинных считываний. Биоинформатика 36 , 2253–2255 (2020).

    CAS
    PubMed

    Google ученый

  • 52.

    Vollger, M. R. et al. Улучшенная сборка и обнаружение вариантов гаплоидного генома человека с использованием одномолекулярных длинных считываний с высокой точностью. Ann. Гм. Genet. 84 , 125–140 (2020).

    CAS
    PubMed

    Google ученый

  • 53.

    Венгер, А.M. et al. Высокоточное долгосрочное секвенирование улучшает обнаружение вариантов и сборку генома человека. Nat. Biotechnol. 37 , 1155–1162 (2019). Это исследование представляет считывание PacBio HiFi как новый тип данных и показывает возможности высокоточного (более 99%), длинного (более 10 кб) считывания для сборки генома de novo и обнаружения структурных вариантов .

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 54.

    Vollger, M. R. et al. Долго читаемая последовательность и сборка сегментарных дупликаций. Nat. Методы 16 , 88–94 (2019). В этой статье дается количественная оценка степени, в которой сегментарные дупликации остаются несобранными в геномах с длительным считыванием. Кроме того, в нем описан метод локального восстановления сегментных дубликатов путем разбиения давно считываемых данных последовательности с использованием графов вариантов паралогичных последовательностей и их локальной сборки .

    CAS
    PubMed

    Google ученый

  • 55.

    Nurk, S. et al. HiCanu: точная сборка сегментарных дупликаций и аллельных вариантов из высокоточных длинных считываний. Препринт на bioRxiv https://doi.org/10.1101/2020.03.14.9

    (2020).

    Артикул

    Google ученый

  • 56.

    Miao, H. et al. Долгосрочное секвенирование выявило причинно-следственный структурный вариант в случае отрицательного экзома и позволило провести преимплантационную генетическую диагностику. Наследие 155 , 32 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 57.

    Вик, Р. Р., Джадд, Л. М. и Холт, К. Э. Производительность инструментов вызова нейронной сети для определения последовательности Oxford Nanopore. Genome Biol. 20 , 129 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 58.

    Li, C. et al. INC-Seq: точное считывание одиночных молекул с помощью секвенирования нанопор. Gigascience 5 , 34 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 59.

    Уилсон, Б. Д., Эйзенштейн, М. и Сох, Х. Т. Высокоточное нанопорное секвенирование ультракоротких ДНК-мишеней. Анал. Chem. 91 , 6783–6789 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 60.

    Oxford Nanopore.Набор 1D в квадрате, доступный в магазине: повышение точности, простая подготовка. Oxford Nanopore Technologies http://nanoporetech.com/about-us/news/1d-squared-kit-available-store-boost-accuracy-simple-prep (2017).

  • 61.

    Lewandowski, K. et al. Метагеномное нанопорное секвенирование вируса гриппа непосредственно из клинических респираторных образцов. J. Clin. Microbiol. 58 , e00963-19 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 62.

    Charalampous, T. et al. Метагеномика нанопор позволяет быстро диагностировать бактериальную инфекцию нижних дыхательных путей. Nat. Biotechnol. 37 , 783–792 (2019).

    CAS
    PubMed

    Google ученый

  • 63.

    Quick, J. et al. Портативное секвенирование генома в реальном времени для эпиднадзора за Эболой. Природа 530 , 228–232 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 64.

    Pendleton, M. et al. Сборка и диплоидная архитектура индивидуального генома человека с помощью одномолекулярных технологий. Nat. Методы 12 , 780–786 (2015).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 65.

    Okubo, M. et al. Экспансия повтора GGC NOTCh3NLC у взрослых пациентов с лейкоэнцефалопатией. Ann. Neurol. 86 , 962–968 (2019).

    CAS
    PubMed

    Google ученый

  • 66.

    Sone, J. et al. Секвенирование с длительным считыванием идентифицирует экспансию повторов GGC в NOTCh3NLC, связанную с нейрональным заболеванием внутриядерного включения. Nat. Genet. 51 , 1215–1221 (2019). Авт. Показывают, что PacBio CLRs и длинные чтения ONT могут обнаруживать структурные вариации в клинически значимых генах риска заболевания, которые ранее были упущены при коротком считывании всего экзома и полногеномного секвенирования .

    CAS
    PubMed

    Google ученый

  • 67.

    Stefansson, H. et al. Большие рецидивирующие микроделеции, связанные с шизофренией. Природа 455 , 232–236 (2008).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 68.

    Sharp, A. J. et al. Обнаружение ранее не идентифицированных геномных нарушений из архитектуры дупликации генома человека. Nat. Genet. 38 , 1038–1042 (2006).

    CAS
    PubMed

    Google ученый

  • 69.

    Hsieh, P. et al. Адаптивная архаичная интрогрессия вариантов числа копий и открытие ранее неизвестных генов человека. Наука 366 , eaax2083 (2019). Авторы описывают большие структурные варианты, происходящие от неандертальцев или денисовцев, которые демонстрируют признаки адаптации и положительного отбора в популяции Меланезии. В частности, они используют длинные считывания для сборки полиморфизма дупликации 386 kb, который присутствует у 79% меланезийцев, но обычно отсутствует в других популяциях, демонстрируя важность разработки новых эталонных геномов человека .

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 70.

    Shi, L. et al. Долговременное секвенирование и сборка de novo китайского генома. Nat. Commun. 7 , 12065 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 71.

    Seo, J.-S. и другие. De novo Сборка и этапирование корейского генома человека. Природа 538 , 243–247 (2016).

    CAS
    PubMed

    Google ученый

  • 72.

    Международный консорциум проектов генома человека. Начальная последовательность и анализ человеческого генома. Природа 409 , 860–921 (2001).

    Google ученый

  • 73.

    Koren, S. et al. Canu: масштабируемая и точная сборка с длинным считыванием за счет адаптивного взвешивания k-mer и разделения повторов. Genome Res. 27 , 722–736 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 74.

    Chin, C.-S. & Халак, А. Сборка генома человека за 100 минут. Препринт на bioRxiv https://doi.org/10.1101/705616 (2019). В этой статье описывается уникальный и быстрый алгоритм сборки генома под названием Peregrine, который использует данные PacBio HiFi. Этот долго читаемый ассемблер способен собрать человеческий геном менее чем за 100 минут или ~ 30 процессорных часов .

    Артикул

    Google ученый

  • 75.

    Chin, C.-S. и другие. Поэтапная диплоидная сборка генома с секвенированием одной молекулы в реальном времени. Nat. Методы 13 , 1050–1054 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 76.

    Колмогоров М., Юань Дж., Лин Ю. и Певзнер П. А. Сборка длинных, подверженных ошибкам операций чтения с использованием графов повторений. Nat. Biotechnol. 37 , 540–546 (2019).

    CAS
    PubMed

    Google ученый

  • 77.

    Ruan, J. & Li, H. Быстрая и точная сборка с долгим чтением с wtdbg2. Nat. Методы 17 , 155–158 (2020).

    CAS
    PubMed

    Google ученый

  • 78.

    Steinberg, K. M. et al. Качественная сборка индивида йорубанского происхождения.Препринт на bioRxiv https://doi.org/10.1101/067447 (2016).

    Артикул

    Google ученый

  • 79.

    Oliver, J. S. et al. Электронные карты генома высокого разрешения на основе данных отдельных молекул. Препринт на bioRxiv https://doi.org/10.1101/139840 (2017).

    Артикул

    Google ученый

  • 80.

    Удалл, Дж. А. и Доу, Р. К. Правильно ли заказано? Проверка сборки генома с помощью оптического картирования. Растительная клетка 30 , 7–14 (2018).

    CAS
    PubMed

    Google ученый

  • 81.

    Ameur, A. et al. Сборка de novo двух шведских геномов выявляет недостающие сегменты из эталона GRCh48 человека и улучшает вызов вариантов данных секвенирования в масштабе популяции. Гены 9 , 486 (2018).

    PubMed Central

    Google ученый

  • 82.

    Li, H. Выравнивающие последовательности считывания, последовательности клонирования и контиги сборки с BWA-MEM. Препринт на arXiv https://arxiv.org/abs/1303.3997 (2013).

  • 83.

    Уотсон, М. и Уорр, А. Ошибки в сборках с длительным считыванием могут критически повлиять на предсказание белка. Nat. Biotechnol. 37 , 124–126 (2019).

    CAS
    PubMed

    Google ученый

  • 84.

    Корен, С., Филлиппи, А. М., Симпсон, Дж. Т., Ломан, Н. Дж. И Луз, М. Ответ на «Ошибки в сборках для длительного чтения могут критически повлиять на предсказание белка». Nat. Biotechnol. 37 , 127–128 (2019).

    CAS
    PubMed

    Google ученый

  • 85.

    Loman, N.J., Quick, J. & Simpson, J. T. Собран полный бактериальный геном de novo с использованием только данных секвенирования нанопор. Nat. Методы 12 , 733–735 (2015).

    CAS
    PubMed

    Google ученый

  • 86.

    Simpson, J. T. et al. Обнаружение метилирования цитозина ДНК с помощью секвенирования нанопор. Nat. Методы 14 , 407–410 (2017). Авторы сообщают о методе обнаружения метилированных цитозинов в необработанных чтениях ONT на основе характерных нарушений сигнала в данных ONT с использованием вычислительного инструмента Nanopolish. Этот инструмент используется для картирования метилирования внутри центромеры .

    CAS
    PubMed

    Google ученый

  • 87.

    Koren, S. et al. De novo Сборка геномов с разрешенными гаплотипами с помощью трио биннинга. Nat. Biotechnol. 36 , 1174–1182 (2018). Авт. Демонстрируют метод фазирования гаплотипов для сборки генома de novo, известный как trio binning, в котором чтения от родителей используются для идентификации и разделения чтения от ребенка на гаплотипы перед сборкой последовательности .

    CAS

    Google ученый

  • 88.

    Porubský, D. et al. Прямое гаплотипирование по длине хромосомы путем секвенирования одной клетки. Genome Res. 26 , 1565–1574 (2016).

    PubMed
    PubMed Central

    Google ученый

  • 89.

    Patterson, M. et al. WhatsHap: взвешенная сборка гаплотипов для чтения секвенирования будущего поколения. J. Computational Biol. 22 , 498–509 (2015).

    CAS

    Google ученый

  • 90.

    Kronenberg, Z. N. et al. Расширенное фазирование гаплотипов сборок генома de novo с помощью FALCON-Phase. Препринт на bioRxiv https://doi.org/10.1101/327064 (2019).

    Артикул

    Google ученый

  • 91.

    Порубский Д. и др. Полностью поэтапная точная сборка индивидуального генома человека.Препринт на bioRxiv https://doi.org/10.1101/855049 (2019).

    Артикул

    Google ученый

  • 92.

    Eichler, E. E. Недавняя дупликация, наращивание домена и динамическая мутация генома человека. Trends Genet. 17 , 661–669 (2001).

    CAS
    PubMed

    Google ученый

  • 93.

    Родригес, О. Л., Ритц, А., Шарп, А. Дж.И Башир, А. MsPAC: инструмент для определения структурных вариантов по гаплотипам. Биоинформатика 36 , 922–924 (2019).

    PubMed Central

    Google ученый

  • 94.

    Бзикадзе, А.В. и Певзнер, П.А. centroFlye: сборка центромер с длинными подверженными ошибкам чтениями. Препринт на bioRxiv https://doi.org/10.1101/772103 (2019).

    Артикул

    Google ученый

  • 95.

    Ebbert, M. T. W. et al. Систематический анализ темных и замаскированных генов выявляет гены, связанные с заболеванием, которые прячутся на виду. Genome Biol. 20 , 97 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 96.

    Feng, Z. et al. Обнаружение модификаций ДНК из данных секвенирования SMRT путем моделирования зависимости кинетики полимеразы от контекста последовательности. PLoS Comput. Биол. 9 , e1002935 (2013).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 97.

    Sedlazeck, F. J. et al. Точное обнаружение сложных структурных изменений с помощью секвенирования отдельных молекул. Nat. Методы 15 , 461–468 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 98.

    Чейссон М. Дж. И Теслер Г. Картирование считываний последовательностей отдельных молекул с использованием базового локального выравнивания с последовательным уточнением (BLASR): применение и теория. BMC Bioinformatics 13 , 238 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 99.

    Li, H. Minimap2: попарное выравнивание нуклеотидных последовательностей. Биоинформатика 34 , 3094–3100 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 100.

    Berlin, K. et al. Сборка больших геномов с помощью секвенирования одной молекулы и хеширования с учетом местоположения. Nat. Biotechnol. 33 , 623–630 (2015).

    CAS
    PubMed

    Google ученый

  • 101.

    Mizuguchi, T. et al. Структурная вариация размером 12 т.п.н. при прогрессирующей миоклонической эпилепсии была недавно идентифицирована путем долгого считывания полногеномного секвенирования. J. Hum. Genet. 64 , 359–368 (2019).

    CAS
    PubMed

    Google ученый

  • 102.

    Merker, J. D. et al. Долгосрочное секвенирование генома определяет причинно-следственные структурные вариации менделевской болезни. Genet. Med. 20 , 159–163 (2018).

    CAS
    PubMed

    Google ученый

  • 103.

    Zeng, S. et al. Длительное секвенирование выявило интронные расширения повторов в SAMD12 из китайских родословных, пораженных семейным кортикальным миоклоническим тремором с эпилепсией. J. Med. Genet. 56 , 265–270 (2019).

    CAS
    PubMed

    Google ученый

  • 104.

    Reiner, J. et al. Цитогеномная идентификация и долгосрочное секвенирование одиночной молекулы в режиме реального времени (SMRT) делеции синдрома Барде-Бидла 9 (BBS9). NPJ Genom. Med. 3 , 3 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 105.

    Sato, N. et al. Спиноцеребеллярная атаксия 31 типа связана со «вставленными» пента-нуклеотидными повторами, содержащими (TGGAA) n. Am. J. Hum. Genet. 85 , 544–557 (2009).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 106.

    Dutta, U. R. et al. Картирование точек останова новой транслокации de novo t (X; 20) (q11.1; p13) путем позиционного клонирования и секвенирования с длинным считыванием. Genomics 111 , 1108–1114 (2019).

    CAS
    PubMed

    Google ученый

  • 107.

    de Jong, L.C. et al. Секвенирование с помощью нанопор полноразмерных транскриптов мРНК BRCA1 выявляет совместное возникновение известных событий пропуска экзонов. Breast Cancer Res. 19 , 127 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 108.

    Wenzel, A. et al. Секвенирование одной молекулы в реальном времени в ADTKD-MUC1 позволяет полностью собрать VNTR и точно определить причинные мутации. Sci. Rep. 8 , 4170 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 109.

    Ishiura, H. et al. Расширения некодирующих CGG-повторов при нейрональной болезни внутриядерного включения, окулофарингодистальной миопатии и перекрывающемся заболевании. Nat. Genet. 51 , 1222–1232 (2019).

    CAS
    PubMed

    Google ученый

  • 110.

    Анейчик, Т.и другие. Рассмотрение причинного механизма Х-сцепленной дистонии-паркинсонизма путем интеграции сборки генома и транскриптома. Ячейка 172 , 897–909.e21 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 111.

    Сонг, Дж. Х. Т., Лоу, К. Б. и Кингсли, Д. М. Характеристика специфичного для человека тандемного повтора, связанного с биполярным расстройством и шизофренией. Am. J. Hum. Genet. 103 , 421–430 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 112.

    Carvalho, C.M.B. et al. Переключение межхромосомных матриц как новый молекулярный механизм импринтинга нарушений, связанных с синдромом Темпла. Genome Med. 11 , 25 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 113.

    Giesselmann, P. et al.Анализ расширений коротких тандемных повторов и их состояния метилирования с помощью секвенирования нанопор. Nat. Biotechnol. 37 , 1478–1481 (2019).

    CAS
    PubMed

    Google ученый

  • 114.

    Sulovari, A. et al. Расширение тандемных повторов, специфичных для человека, и дифференциальная экспрессия генов во время эволюции приматов. Proc. Natl Acad. Sci. США 116 , 23243–23253 (2019).

    CAS
    PubMed

    Google ученый

  • 115.

    Lei, X. X. et al. Экспансия повторов TTTCA вызывает семейный корковый миоклонический тремор с эпилепсией. Eur. J. Neurol. 26 , 513–518 (2019).

    CAS
    PubMed

    Google ученый

  • 116.

    Fiddes, I. T. et al. Специфичные для человека гены NOTCh3NL влияют на передачу сигналов Notch и корковый нейрогенез. Ячейка 173 , 1356–1369.e22 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 117.

    Suzuki, I. K. et al. Специфичные для человека гены NOTCh3NL расширяют корковый нейрогенез за счет регуляции Delta / Notch. Ячейка 173 , 1370–1384.e16 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 118.

    Mefford, H.C. et al. Рекуррентные перестройки хромосомы 1q21.1 и вариабельные педиатрические фенотипы. N. Engl. J. Med. 359 , 1685–1699 (2008).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 119.

    Brunetti-Pierri, N. et al. Рецидивирующие реципрокные делеции и дупликации 1q21.1, связанные с микроцефалией или макроцефалией, а также аномалиями развития и поведения. Nat. Genet. 40 , 1466–1471 (2008).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 120.

    He, Y. et al. Долговременная сборка генома китайского макака-резуса и идентификация структурных вариантов, специфичных для обезьян. Nat. Commun. 10 , 4233 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 121.

    Национальный исследовательский институт генома человека. NHGRI финансирует центры по продвижению эталонной последовательности генома человека. Genome.gov https://www.genome.gov/news/news-release/NIH-funds-centers-for-advancing-sequence-of-human-genome-reference (2019).

  • 122.

    Garalde, D. R. et al.Высоко параллельное прямое секвенирование РНК на массиве нанопор. Nat. Методы 15 , 201–206 (2018). Авторы описывают метод секвенирования полноразмерных молекул нативной РНК с технологиями секвенирования ONT, упрощая процесс, удаляя этапы преобразования РНК в кДНК перед секвенированием .

    CAS
    PubMed

    Google ученый

  • 123.

    Workman, R.E. et al. Секвенирование нативной РНК нанопор поли (А) транскриптома человека. Nat. Методы 16 , 1297–1305 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 124.

    Soneson, C. et al. Комплексное исследование секвенирования нативной РНК Nanopore для характеристики сложных транскриптомов. Nat. Commun. 10 , 3359 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 125.

    Flusberg, B.A. et al. Прямое обнаружение метилирования ДНК во время секвенирования одной молекулы в реальном времени. Nat. Методы 7 , 461–465 (2010).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 126.

    Vilfan, I. D. et al. Анализ модификации оснований РНК и структурных перестроек с помощью одномолекулярного обнаружения обратной транскрипции в реальном времени. J. Nanobiotechnol. 11 , 8 (2013).

    CAS

    Google ученый

  • 127.

    Rand, A.C. et al. Картирование метилирования ДНК с помощью высокопроизводительного секвенирования нанопор. Nat. Методы 14 , 411–413 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 128.

    Шарон, Д., Тилгнер, Х., Груберт, Ф. и Снайдер, М. Одномолекулярный долгосрочный обзор человеческого транскриптома. Nat. Biotechnol. 31 , 1009–1014 (2013).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 129.

    Au, K. F. et al. Характеристика транскриптома ESC человека с помощью гибридного секвенирования. Proc. Natl Acad. Sci. США 110 , E4821 – E4830 (2013). В этой статье показано, что транскрипты полноразмерной мРНК могут быть секвенированы от конца до конца для идентификации новых изоформ генов с использованием метода PacBio Iso-Seq.В этой статье также представлен каталог поли (A) транскриптома в человеческих эмбриональных стволовых клетках с использованием комбинации Iso-Seq и данных короткого чтения .

    CAS
    PubMed

    Google ученый

  • 130.

    Byrne, A. et al. RNAseq с длинным считыванием нанопор обнаруживает широко распространенные вариации транскрипции среди поверхностных рецепторов отдельных В-клеток. Nat. Commun. 8 , 16027 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 131.

    Oikonomopoulos, S., Wang, Y.C, Djambazian, H., Badescu, D. & Ragoussis, J. Сравнительный анализ секвенирования Oxford Nanopore MinION для количественной и качественной оценки популяций кДНК. Sci. Отчет 6 , 31602 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 132.

    Dougherty, M. L. et al. Транскрипционные судьбы специфичных для человека сегментарных дупликаций в головном мозге. Genome Res. 28 , 1566–1576 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 133.

    Volden, R. et al. Повышение точности считывания нанопор с помощью метода R2C2 позволяет секвенировать высоко мультиплексированные полноразмерные одноклеточные кДНК. Proc. Natl Acad. Sci. США 115 , 9726–9731 (2018).

    CAS
    PubMed

    Google ученый

  • 134.

    Aird, D. et al. Анализ и минимизация систематической ошибки амплификации ПЦР в библиотеках секвенирования Illumina. Genome Biol. 12 , R18 (2011).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 135.

    Clark, M. B. et al. Долговременное секвенирование показывает сложный профиль сплайсинга гена психиатрического риска CACNA1C в человеческом мозге. Mol Psychiatry 25 , 37–47 (2020).

    CAS
    PubMed

    Google ученый

  • 136.

    Tang, A. D. et al. Характеристика полноразмерного транскрипта мутации SF3B1 при хроническом лимфолейкозе выявляет подавление сохраняемых интронов. Nat. Commun. 11 , 1438 (2020).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 137.

    Clark, T. A. et al. Определение специфичности ДНК-метилтрансферазы с использованием одномолекулярного секвенирования ДНК в реальном времени. Nucleic Acids Res. 40 , e29 (2012).

    CAS
    PubMed

    Google ученый

  • 138.

    Huang, Y. et al. Поведение 5-гидроксиметилцитозина при бисульфитном секвенировании. PLoS One 5 , e8888 (2010).

    PubMed
    PubMed Central

    Google ученый

  • 139.

    Pacific Biosciences. Обнаружение модификаций оснований ДНК с использованием отдельной молекулы, секвенирование в реальном времени. PacBio https://www.pacb.com/wp-content/uploads/2015/09/WP_Detecting_DNA_Base_Modifications_Using_SMRT_Sequencing.pdf (2015).

  • 140.

    Frommer, M. et al. Протокол геномного секвенирования, который дает положительное отображение остатков 5-метилцитозина в отдельных цепях ДНК. Proc. Natl Acad. Sci. США 89 , 1827–1831 (1992).

    CAS
    PubMed

    Google ученый

  • 141.

    Ан, Н., Флеминг, А. М., Уайт, Х. С. и Берроуз, К. Дж. Обнаружение нанопор 8-оксогуанина в последовательности повторов теломер человека. АСУ Нано 9 , 4296–4307 (2015).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 142.

    Liu, H. et al. Точное обнаружение модификаций m 6 A РНК в нативных последовательностях РНК. Nat. Commun. 10 , 4079 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 143.

    Leger, A. et al. Обнаружение модификаций РНК с помощью сравнительного прямого секвенирования РНК Nanopore. Препринт на bioRxiv https://doi.org/10.1101/843136 (2019).

    Артикул

    Google ученый

  • 144.

    Lorenz, D. A., Sathe, S., Einstein, J. M. & Yeo, G. W. Прямое секвенирование РНК позволяет обнаруживать m 6 A в изоформах эндогенных транскриптов при разрешении по основанию. РНК https://doi.org/10.1261/rna.072785.119 (2019).

    Артикул
    PubMed

    Google ученый

  • 145.

    Li, Y. & Tollefsbol, T. O. Обнаружение метилирования ДНК: бисульфитный анализ геномного секвенирования. Methods Mol. Биол. 791 , 11–21 (2011).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 146.

    Шефер М., Поллекс Т., Ханна К. и Лико Ф. Анализ метилирования цитозина РНК с помощью бисульфитного секвенирования. Nucleic Acids Res. 37 , е12 (2009 г.).

    PubMed

    Google ученый

  • 147.

    Levanon, E. Y. et al. Систематическая идентификация множества сайтов редактирования A-to-I в человеческом транскриптоме. Nat. Biotechnol. 22 , 1001–1005 (2004).

    CAS
    PubMed

    Google ученый

  • 148.

    Incarnato, D. et al. Высокопроизводительное картирование с разрешением одного основания 2΄-O-метилированных остатков РНК. Nucleic Acids Res. 45 , 1433–1441 (2017).

    CAS
    PubMed

    Google ученый

  • 149.

    Бакин А. В. и Офенганд Дж. Картирование псевдоуридиновых остатков в РНК для разрешения нуклеотидов. Methods Mol. Биол. 77 , 297–309 (1998).

    CAS
    PubMed

    Google ученый

  • 150.

    Цай, Ю.-К. и другие. Без амплификации, целевое обогащение CRISPR-Cas9 и SMRT-секвенирование геномных областей, вызывающих болезнь, вызывающую повторную экспансию.Препринт на bioRxiv https://doi.org/10.1101/203919 (2017).

    Артикул

    Google ученый

  • 151.

    Hafford-Tear, N.J. et al. CRISPR / Cas9-целевое обогащение и долгосрочное секвенирование триплетного повтора TCF4, связанного с эндотелиальной дистрофией роговицы Fuchs. Genet. Med. 21 , 2092–2102 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 152.

    Suzuki, Y. et al. AgIn: измерение ландшафта метилирования CpG отдельных повторяющихся элементов. Биоинформатика 32 , 2911–2919 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 153.

    Ni, P. et al. DeepSignal: обнаружение состояния метилирования ДНК из считывания секвенирования нанопор с использованием глубокого обучения. Биоинформатика 35 , 4586–4595 (2019).

    CAS
    PubMed

    Google ученый

  • 154.

    Макинтайр, А. Б. Р. и др. Определение N6-метиладенина с помощью секвенирования одной молекулы в эталонных микробных материалах. Nat. Commun. 10 , 579 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 155.

    Liu, Q. et al. Обнаружение модификаций оснований ДНК глубокой рекуррентной нейронной сетью по данным секвенирования Oxford Nanopore. Nat. Commun. 10 , 2449 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 156.

    Stoiber, M. et al. Идентификация de novo модификаций ДНК благодаря обработке сигналов нанопор, управляемой геномом. Препринт на bioRxiv https://doi.org/10.1101/094672 (2017).

    Артикул

    Google ученый

  • 157.

    Lee, I. et al. Одновременное профилирование доступности и метилирования хроматина на линиях клеток человека с секвенированием нанопор. Препринт на bioRxiv https://doi.org/10.1101/504993 (2019).

    Артикул

    Google ученый

  • 158.

    Beyter, D. et al. Длительное секвенирование 1817 исландцев дает представление о роли структурных вариантов в заболеваниях человека. Препринт на bioRxiv https://doi.org/10.1101/848366 (2019).

    Артикул

    Google ученый

  • 159.

    Garrison, E. et al. Набор инструментов графа вариаций улучшает отображение считываемых данных, представляя генетические вариации в ссылке. Nat. Biotechnol. 36 , 875–879 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 160.

    Schneider, V.A. et al. Оценка сборок гаплоидных геномов GRCh48 и de novo демонстрирует неизменное качество эталонной сборки. Genome Res. 27 , 849–864 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 161.

    Li, R. et al. Построение карты последовательностей пангенома человека. Nat. Biotechnol. 28 , 57–63 (2010).

    CAS
    PubMed

    Google ученый

  • 162.

    Gnerre, S. et al. Высококачественные черновые сборки геномов млекопитающих из массивно параллельных данных последовательностей. Proc. Natl Acad. Sci. США 108 , 1513–1518 (2011).

    CAS
    PubMed

    Google ученый

  • 163.

    Сандерс, А. Д., Фалконер, Э., Хиллс, М., Спирингс, Д. С. Дж. И Лансдорп, П. М. Секвенирование одной цепи матрицы-матрицы с помощью Strand-seq позволяет характеризовать отдельные гомологи. Nat. Protoc. 12 , 1151–1176 (2017).

    CAS
    PubMed

    Google ученый

  • 164.

    Sanders, A. D. et al. Одноячеечный анализ структурных вариаций и сложных перестроек с трехканальной обработкой. Nat. Biotechnol. 38 , 343–354 (2020).

    CAS
    PubMed

    Google ученый

  • 165.

    Порубский Д. и др. Плотное и точное гаплотипирование отдельных геномов по всей хромосоме. Nat. Commun. 8 , 1293 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 166.

    Wu, J. K et al. Синдром тромбоцитопении-отсутствующей лучевой кости: история вопроса, патофизиология, эпидемиология. Medscape https://reference.medscape.com/article/959262-overview (2019).

  • 167.

    Rosenfeld, J. A. et al. Проксимальные микроделеции и микродупликации 1q21.1 вносят вклад в различные аномальные фенотипы. Eur. J. Hum. Genet. 20 , 754–761 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • Expanded ENCODE — бесценная геномная энциклопедия

    Менее 2% генома человека кодирует белки 1 .Грандиозной задачей для геномных наук было составить карту функциональных элементов — регионов, которые определяют степень экспрессии генов — в оставшихся 98% нашей ДНК. Проект «Энциклопедия элементов ДНК» (ENCODE), среди других крупных совместных усилий 2 4 , был основан в 2003 году для создания каталога этих функциональных элементов и описания их роли в регуляции экспрессии генов. В девяти статьях в Nature 5 13 консорциум ENCODE представляет третью фазу своего ценного проекта.

    В 2007 году на пилотной фазе проекта ENCODE проводился поиск функциональных элементов в 1% генома в нескольких линиях клеток человека 14 . Консорциум каталогизировал два типа этих элементов. Во-первых, они идентифицировали участки ДНК, которые транскрибируются в РНК (кодирующие и не кодирующие белок). Во-вторых, они идентифицировали участки ДНК, которые регулируют транскрипцию генов, известные как цис -регуляторные элементы (CRE). Эти области можно идентифицировать по их доступности для ДНК-расщепляющих ферментов, таких как ДНКаза I, по ДНК-связывающим белкам, таким как факторы транскрипции, или по специфическим молекулярным модификациям гистоновых белков, с которыми ДНК связана в комплексе, называемом хроматином.

    В 2012 году вторая фаза проекта ENCODE расширила поиск этих функциональных элементов на весь геном в других клеточных линиях человека 15 , заложив прочную основу для энциклопедии. Аналогичные усилия были распространены на геном мыши в 2014 году, что углубило наше понимание этих элементов с эволюционной точки зрения 16 .

    На текущем третьем этапе проекта консорциум перешел от клеточных линий к клеткам, взятым непосредственно из тканей человека и мыши, создав более биологически значимую энциклопедию.Они также представили анализы для исследования более широких аспектов функциональных элементов — например, для характеристики элементов, встроенных в РНК, или для анализа образования петель хроматина, которое сближает отдельные CRE для обеспечения регуляции генов (Рис. 1).

    Рисунок 1 | Изучение функциональных элементов генома. Девять статей 5 13 из проекта «Энциклопедия элементов ДНК» (ENCODE) каталогизируют широкий спектр аспектов организации и регуляции генома.Консорциум подготовил каталог цис -регуляторных элементов (CRE) — последовательностей ДНК, называемых промоторами и энхансерами, которые регулируют транскрипцию (черная стрелка) генов в близких или удаленных геномных сайтах соответственно. Исследователи проанализировали последовательности ДНК и РНК, а также связанные с ними белки, в том числе гистоновые белки, вокруг которых ДНК упакована в виде хроматина. Они также изучали молекулярные модификации ДНК и гистонов, включая участки метилирования ДНК. Эти модификации могут привести к изменениям в регуляции генов и образованию петель хроматина, что может привести энхансеры в тесный контакт с генами, которые они регулируют.

    Во флагманской статье Консорциум проекта ENCODE et al. 5 представляют обновленную энциклопедию с высоты птичьего полета, которая содержит недавно добавленные наборы данных из 6000 экспериментов, выполненных примерно на 1300 образцах. Объединив эти наборы данных, консорциум создал онлайн-реестр кандидатов CRE. Большинство из них классифицируются как промоторы или энхансеры — CRE, расположенные соответственно на или на некотором расстоянии от геномного сайта, в котором начинается транскрипция гена.Консорциум отслеживал активность каждого кандидата CRE вместе с белками, которые с ним связываются, во многих различных образцах из различных тканей. Они использовали данные о петле хроматина, чтобы связать энхансеры с генами, которые они могут регулировать. Этот онлайн-реестр знаменует собой настоящую веху, превратив подавляющее количество геномной информации в доступную для поиска, фильтруемую и извлекаемую энциклопедию элементов ДНК, которая находится в свободном доступе по адресу https://screen.encodeproject.org.

    Восемь сопутствующих статей, а также Perspective 17 в этом выпуске и статьи в нескольких родственных журналах Nature (см.nature.com/encode), погрузитесь в биологию, лежащую в основе этого проекта. В этих исследованиях использовались масштаб и разнообразие наборов данных ENCODE, чтобы выявить принципы, регулирующие работу функциональных элементов. Вместе документы демонстрируют ценность крупномасштабного производства данных в биологии.

    Чтобы идентифицировать CRE, Мейлеман и его коллеги 6 определили 3,6 миллиона доступных областей ДНК в 438 типах и состояниях клеток и тканей путем измерения чувствительности всего генома к ДНКазе I.Vierstra и др. 7 далее исследовали паттерны расщепления ДНКазой I, чтобы понять, как факторы транскрипции связываются с CRE. Они пришли к выводу, что большинство CRE занято множественными факторами транскрипции независимым и хорошо разнесенным образом.

    Чтобы лучше понять, как факторы транскрипции взаимодействуют с CRE, Партридж и его коллеги 8 картировали связывание 208 белков (включая 171 фактор транскрипции) в геноме линии клеток печени человека.Это почти четверть белков, которые связываются с хроматином в этой клеточной линии — беспрецедентный уровень охвата. На карте выделено около 5000 высоко занятых целевых (HOT) регионов, в основном промоторов и энхансеров, которые связаны многими факторами транскрипции.

    Сильно занятые области-мишени были описаны до 18 , но — путем анализа паттернов, в которых белки совместно собираются в этих областях, и последовательностей ДНК, с которыми они связываются, Partridge et al. предоставили первое исчерпывающее свидетельство в поддержку спекулятивной модели формирования HOT-региона 18 . Согласно этой модели, набор якорных последовательностей ДНК сначала привлекает специфические факторы транскрипции. Эти белки увеличивают доступность хроматина, а затем служат ядром, вокруг которого собираются другие связывающие белки, независимо от последовательности ДНК. Это может происходить посредством белок-белковых взаимодействий и петель хроматина, которые могут связывать вместе несколько удаленных CRE.

    Чтобы лучше понять, как удаленные CRE работают вместе, Grubert et al . 9 картированных петель хроматина в 24 типах клеток человека. Они показали, что различия в образовании петель хроматина между типами клеток могут влиять на экспрессию генов, изменяя, какие удаленные энхансерные элементы регулируют ген и какие участки гена сохраняются после транскрипции (процесс, называемый альтернативным сплайсингом). Их наиболее интригующее открытие заключалось в том, что гены домашнего хозяйства (те, которые участвуют в повседневном обслуживании клеток) часто взаимодействуют всего с несколькими элементами энхансера, тогда как многие энхансеры вступают в контакт с генами, вызывающими заболевание, если одна из двух копий мутирует.Это означает, что более простая схема способствует устойчивой и постоянной экспрессии, тогда как более сложная схема необходима для защиты экспрессии «чувствительных к дозе» генов.

    Три другие статьи исследуют регуляторные роли CRE с точки зрения развития путем анализа множества тканей эмбрионов мышей на нескольких стадиях развития. Yupeng He и др. . 10 исследовали закономерности модификации ДНК метильными группами; Горкин и др. . 11 изучали модификацию гистонов и доступность хроматина на уровне всей ткани; и Peng He и др. . 12 проанализировали профили экспрессии генов на одноклеточном уровне.

    Первые два из этих исследований 10 , 11 вместе раскрывают общий принцип регуляции онтогенетических генов: с течением времени происходит постоянное удаление метильных меток, которые способствуют стабильному сайленсингу генов для обеспечения быстрых и гибких режимов регуляция генов, контролируемая модификациями гистонов и доступностью хроматина.Интересно, что обе группы продемонстрировали, что человеческие эквиваленты некоторых энхансерных элементов мыши — тех, которые активны только в определенных тканях — обогащены генетическими вариантами, связанными с заболеваниями, относящимися к соответствующей ткани. Это наблюдение подчеркивает важность изучения CRE у животных.

    В третьем исследовании 12 Пэн Хе и его коллеги использовали одноклеточное разрешение своих данных по экспрессии генов, чтобы вычислительно «разложить» результаты для всей ткани из первых двух исследований.Таким образом, они могут предсказать, какие энхансерные элементы активны в определенных типах клеток ткани. Это исследование является прекрасной демонстрацией того, как интегративный анализ повышает ценность данных нескольких исследований.

    Наконец, Ван Ностранд и др. . 13 представляют собой комплексный анализ функциональных элементов РНК путем умной интеграции нескольких анализов. Авторы проанализировали последовательности РНК, которые связывают РНК-белки с in vitro . Затем они использовали эти данные для интерпретации результатов другого анализа, который идентифицирует последовательности РНК, связанные с РНК-связывающими белками in vivo .Чтобы исследовать влияние РНК-связывающих белков на гены (с точки зрения уровня экспрессии и альтернативных паттернов сплайсинга), они интегрировали свою информацию о связывании с анализами профилей экспрессии генов клеток, в которых были ингибированы определенные РНК-связывающие белки. Это выявило потенциальную роль некоторых элементов РНК в стабильности РНК и альтернативном сплайсинге.

    Одним из удивительных открытий было то, что около половины описанных РНК-связывающих белков взаимодействуют с ДНК так же, как и с РНК. Однако авторы обнаружили мало доказательств того, что белки связываются с обоими типами молекул на сайтах с одинаковой последовательностью.Это предполагает, что взаимодействия большинства РНК-связывающих белков с ДНК не опосредуются РНК, связанными с хроматином в месте их синтеза. Необходимы дальнейшие исследования, чтобы оценить, происходят ли эти взаимодействия посредством прямого связывания, опосредуются ли другими ДНК-связывающими белками или опосредуются РНК, связанными с хроматином вне места их синтеза.

    Этот каталог элементов РНК существенно расширяет наши знания о регуляторных компонентах, закодированных в геноме человека. Это должно позволить исследователям предсказать генетические варианты, которые изменяют процессинг РНК, и станет бесценным ресурсом для исследования того, как регулируются взаимодействия белок-РНК.

    Третья фаза проекта ENCODE — это тур де силы. Но поскольку многие регуляторные элементы действуют только в определенных типах клеток или в определенное время, невозможно точно оценить полноту энциклопедии. Было бы интересно посмотреть, как в проект могут быть включены одноклеточные технологии для выделения пространственно-временных специфических элементов и, таким образом, для дальнейшего раскрытия основ регуляции генов. Мы также хотели бы видеть сближение проекта ENCODE с совместными усилиями, которые имеют перекрывающиеся области применения, например, Атлас клеток человека 19 (который направлен на отображение экспрессии генов во всех клетках человеческого тела) и 4D Nucleome проект 20 (цель которого — понять трехмерную организацию хромосомы в разное время и в разных типах клеток).Включение соответствующих данных из этих проектов в энциклопедию еще больше расширит ее охват.

    Эта энциклопедия, которую еще предстоит завершить, уже стала основным инструментом для понимания регуляции генов и генетической предрасположенности к болезням. В предстоящей четвертой фазе проекта ENCODE мы были бы рады увидеть систематическую оценку того, действительно ли каталогизированные CRE выполняли функции, предполагаемые на основе модификаций гистонов и связанных белков; это может быть достигнуто с помощью высокопроизводительных функционально-геномных технологий.Продолжающееся распространение ENCODE на более широкий биологический контекст (например, образцы болезней и редкие типы клеток) при разрешении отдельных клеток поможет исследователям использовать геномную информацию для диагностики и предотвращения заболеваний.

    длинных чтений революционизируют 20-летнюю историю секвенирования генома насекомых | Геном, биология и эволюция

    Аннотация

    Первая сборка генома насекомых ( Drosophila melanogaster ) была опубликована два десятилетия назад.Сегодня сборки ядерного генома доступны для 601 вида насекомых, представляющих 20 отрядов. В этом исследовании мы проанализировали наиболее смежные сборки для каждого вида и представили перспективу «состояния поля», уделяя особое внимание таксономической репрезентативности, качеству сборки, полноте генов и технологиям секвенирования. Что касается видового богатства, геномные усилия были смещены в сторону четырех отрядов (Diptera, Hymenoptera, Collembola и Phasmatodea), жесткокрылые недостаточно представлены, а 11 отрядов все еще не имеют общедоступной сборки генома.Средняя длина сборки генома насекомых составляет 439,2 Мбайт, при этом 87,5% генов эталонного тестирования не повреждены. Наиболее заметным было влияние долгочитаемого секвенирования; сборки, которые включают длинные чтения, в ~ 48 раз более смежны, чем те, которые этого не делают. Мы предлагаем четыре рекомендации по мере того, как мы все вместе продолжаем создавать ресурсы генома насекомых: 1) стремиться к лучшей интеграции между независимыми исследовательскими группами и консорциумами, 2) сбалансировать будущую выборку между заполнением таксономических пробелов и генерированием данных для целевых вопросов, 3) воспользоваться преимуществом долгого секвенирования технологии, и 4) расширять и улучшать аннотации генов.

    С тех пор, как примерно 20 лет назад был секвенирован первый геном насекомого, технологии секвенирования и доступность сборок генома насекомых значительно продвинулись вперед. В этом исследовании мы курировали, анализировали и обобщали область геномики насекомых с точки зрения таксономического представления, качества сборки, полноты генов и технологии секвенирования. Мы показываем, что у 601 вида насекомых есть доступные наборы генома, при этом некоторые группы сильно перепредставлены (например, двукрылые) по сравнению с другими (например, двукрылые).g., жесткокрылые). Главный вывод нашего исследования состоит в том, что сборки генома, полученные с помощью длинного чтения, в ~ 48 раз более смежны, чем сборки короткого чтения.

    С момента публикации генома Drosophila melanogaster (Адамс и др., 2000), технологии секвенирования и анализа быстро развивались, открывая возможности секвенирования генома постоянно расширяющемуся кругу исследователей. Более 600 насекомых секвенировали свой ядерный геном и сделали его общедоступным в репозитории GenBank (Sayers et al.2021 г.). Хотя это составляет всего 0,06% от ~ 1 миллиона описанных насекомых (Stork, 2018), эта широта секвенирования генома насекомых по-прежнему охватывает ~ 480 млн лет эволюции (Misof et al.2014) и примерно два порядка размера генома от крошечного генома размером 99 мегабайт. из Belgica antarctica (Kelley et al. 2014) в массивный геном Locusta migratoria на 6.5 Гб (Wang et al. 2014).

    Накопление геномных ресурсов трансформировало биологические исследования и ускорило значительный прогресс в нашем понимании происхождения биоразнообразия (Seehausen et al.2014; Hug et al. 2016; McKenna et al. 2019; McGee et al. 2020). Значительный прогресс был достигнут благодаря крупномасштабным консорциумам (например, Проект генома человека [Collins et al. 2003]; Проект генома позвоночных [Rhie et al. 2021]), а для насекомых наиболее заметным консорциумом была инициатива i5K по секвенированию геномов 5000 различных членистоногих (Robinson et al. 2011; i5K Consortium 2013). Развитие технологий секвенирования с длинным считыванием — в первую очередь Oxford Nanopore и Pacific Biosciences (PacBio) — также изменило ландшафт секвенирования генома, предоставив экономичные средства для высокопроизводительной генерации считываний, размер которых обычно составляет 25 кбайт или больше (Amarasinghe et al. .2020), тем самым значительно увеличивая средний размер последовательностей, используемых в сборках. Однако усилия по секвенированию генома у насекомых распределялись неравномерно. Водные насекомые, как группа, недопредставлены по сравнению с их наземными собратьями (Hotaling et al.2020). И некоторые отряды (например, Diptera) представлены гораздо большим количеством геномных ансамблей, чем того требует только их видовое разнообразие — вероятно, отражая модельные организмы внутри них — хотя многие отряды все еще не имеют геномного представительства.

    Здесь мы собрали и проанализировали наилучшую доступную сборку генома для 601 насекомого (вида или подвида). Мы предлагаем перспективную перспективу с упором на таксономическое представление, качество сборки, полноту генов и технологию секвенирования. Мы сосредоточились на таксономической широте, а не на внутригрупповых усилиях (например, Anopheles gambiae 1000 Genomes Consortium [2017]), чтобы получить более целостный обзор области. После аналогичных исследований (например, Misof et al.2014; Petersen et al.2019; Хоталинг и др. 2020), мы определили насекомых, чтобы включить все группы в подтипе Hexapoda. Мы загрузили метаданные из GenBank для всех ансамблей генома ядерных гексаподов в порядке очереди (Sayers et al. 2021; по состоянию на 2 ноября 2020 г.). Мы отобрали этот набор данных, чтобы включить только сборку с наивысшим контигом N50 для каждого таксона, и загрузили эти сборки для анализа. Мы признаем, что этот подход к фильтрации может привнести смещение в сторону сегодняшнего дня для сборок, которые были улучшены с годами.Сборки были классифицированы как «короткие чтения», «длинные чтения» или «не предоставлены» в зависимости от того, использовались ли только короткие чтения (например, Illumina), использовалось любое количество последовательностей длительного чтения (например, PacBio) или нет информация была предоставлена. Если в сборке использовались как короткие, так и длинные чтения («гибридная» сборка), в нашем анализе она классифицировалась как сборка с длинным считыванием.

    Чтобы проверить, были ли отряды насекомых недостаточно или чрезмерно представлены с точки зрения доступности сборки генома, мы сравнили наблюдаемое количество таксонов со сборками с ожидаемым количеством, учитывая описанное разнообразие для данного отряда.Мы получили общее количество описанных насекомых в целом и для каждого порядка из предыдущих исследований (Zhang 2011; Bellinger et al. 2020). Мы оценили значимость между наблюдаемым и ожидаемым представлением с помощью точных тестов Фишера. Чтобы оценить полноту гена, мы запустили «Бенчмаркинг универсальных ортологов с одной копией» (BUSCO) v.4.1.4 (Seppey et al., 2019) для каждой сборки, используя 1367 референсных генов в наборе генов OrthoDB v.10 Insecta (Кривенцева и др. др.2019). Следует отметить, что сборки генома Collembola могли получить несколько более низкие баллы BUSCO в этом анализе, потому что геномы гексапод, не принадлежащих насекомым, не использовались для создания набора генов Insecta.Мы проверили различия в распределении контига N50 или размера сборки между сборками с коротким и длинным считыванием с помощью тестов Welch t . Затем, используя набор генов BUSCO, мы проверили, будут ли более длинные гены с большей вероятностью отсутствовать или фрагментироваться в зависимости от технологии секвенирования (короткое или длинное считывание) с корреляциями Спирмена. Мы определили длину гена BUSCO как полную нуклеотидную последовательность для кодирующих белок частей консенсусных «предковых» генов, включенных в набор генов OrthoDB v.10 Insecta.Расширенная версия методов и скриптов, используемых для анализа, представлена ​​в дополнительных материалах, дополнительных материалах в Интернете и в репозитории GitHub (https://github.com/pbfrandsen/insect_genome_assemblies, последний доступ 15 июля 2021 г.).

    По состоянию на ноябрь 2020 года у 601 различных видов насекомых, представляющих 20 порядков, сборки ядерного генома были доступны в GenBank. В этих данных преобладали двукрылые ( n = 169 сборок), перепончатокрылые ( n = 164) и чешуекрылые ( n = 118; рис.1а). Четыре отряда были перепредставлены по своему видовому разнообразию: Collembola, Diptera, Hymenoptera и Phasmatodea ( P , Fisher’s <0,03; рис. 1a). Жесткокрылые, насчитывающие 387 100 описанных видов (Zhang 2011), были значительно недопредставлены (41 собрание против ожидаемых ∼228; P , Фишера <0,01). Шесть заказов были представлены только одной сборкой генома, а 11 заказов не имели общедоступной сборки. Это отсутствие представительства было особенно поразительным для Neuroptera (5 868 описанных видов, Zhang 2011).

    Рис. 1

    Таксономическое представление, смежность и временная шкала доступности для наиболее непрерывной сборки ядерного генома для 601 вида насекомых в GenBank по состоянию на ноябрь 2020 года. Включена только одна сборка для каждого названного вида или подвида. ( a ) Таксономическое разнообразие имеющихся наборов генома насекомых. Наблюдаемое и ожидаемое количество сборок генома представляет собой общее количество доступных сборок по сравнению с ожидаемым с учетом той пропорции, в которой каждый отряд включает все описанное разнообразие насекомых.Значимость оценивалась с помощью точных тестов Фишера. Один отряд недопредставлен (Coleoptera), тогда как четыре отряда перепредставлены (Diptera, Hymenoptera, Collembola, Phasmatodea). Одиннадцать отрядов (светло-красные силуэты) не имеют общедоступной сборки генома. Разбивка технологии секвенирования по заказам показана на дополнительном рисунке S1, Дополнительный материал в Интернете. ( b ) Смежность генома по сравнению с общей длиной сборки. Смежность оценивалась с помощью контига N50, средней точки распределения контигов, когда 50% генома собрано в контиги заданной длины или более.На врезке показано сравнение распределений контигов N50 для сборок с коротким считыванием ( n = 365) и сборок с длинным считыванием ( n = 126). Значимость оценивалась с помощью теста Велча t . Более подробная разбивка по технологии секвенирования показана на дополнительном рисунке S2, Дополнительный материал онлайн. ( c ) Временная шкала доступности сборки генома для насекомых согласно дате публикации GenBank . Устойчивое увеличение смежности в значительной степени обусловлено ростом секвенирования с длинным считыванием.Помечены в ( b ) и ( c ): хорошо известные или выпадающие сборки генома с точки зрения статуса модели, размера сборки или смежности. Группы видов одного рода помечены черными кружками. ( d ) Contig N50 по таксономической группе. Как правило, таксоны были сгруппированы в отряды, за исключением случаев, когда 10 или более сборок были доступны для более низкого таксономического уровня (семейства или рода). Как и в ( b ) и ( c ), каждая точка представляет собой единую сборку генома насекомого.

    Рис. 1

    Таксономическое представление, смежность и временная шкала доступности для наиболее непрерывной сборки ядерного генома для 601 вида насекомых в GenBank по состоянию на ноябрь 2020 года. Включена только одна сборка для каждого названного вида или подвида. ( a ) Таксономическое разнообразие имеющихся наборов генома насекомых. Наблюдаемое и ожидаемое количество сборок генома представляет собой общее количество доступных сборок по сравнению с ожидаемым с учетом той пропорции, в которой каждый отряд включает все описанное разнообразие насекомых.Значимость оценивалась с помощью точных тестов Фишера. Один отряд недопредставлен (Coleoptera), тогда как четыре отряда перепредставлены (Diptera, Hymenoptera, Collembola, Phasmatodea). Одиннадцать отрядов (светло-красные силуэты) не имеют общедоступной сборки генома. Разбивка технологии секвенирования по заказам показана на дополнительном рисунке S1, Дополнительный материал в Интернете. ( b ) Смежность генома по сравнению с общей длиной сборки. Смежность оценивалась с помощью контига N50, средней точки распределения контигов, когда 50% генома собрано в контиги заданной длины или более.На врезке показано сравнение распределений контигов N50 для сборок с коротким считыванием ( n = 365) и сборок с длинным считыванием ( n = 126). Значимость оценивалась с помощью теста Велча t . Более подробная разбивка по технологии секвенирования показана на дополнительном рисунке S2, Дополнительный материал онлайн. ( c ) Временная шкала доступности сборки генома для насекомых согласно дате публикации GenBank . Устойчивое увеличение смежности в значительной степени обусловлено ростом секвенирования с длинным считыванием.Помечены в ( b ) и ( c ): хорошо известные или выпадающие сборки генома с точки зрения статуса модели, размера сборки или смежности. Группы видов одного рода помечены черными кружками. ( d ) Contig N50 по таксономической группе. Как правило, таксоны были сгруппированы в отряды, за исключением случаев, когда 10 или более сборок были доступны для более низкого таксономического уровня (семейства или рода). Как и в ( b ) и ( c ), каждая точка представляет собой единую сборку генома насекомого.

    В среднем сборки генома насекомых имели длину 439,2 МБ (SD = 448,4 МБ; рис. 2a) со средним контигом N50 1,09 МБ (SD = 4,01 МБ) и 87,5% (SD = 21%) полнота BUSCO (единичная и дублированные гены, вместе взятые). Однако существенные вариации существовали во всех трех показателях, начиная с очень неполной сборки Piezodorus guildini всего 3,2 Мб (contig N50 = 1,5 кб, полнота BUSCO = 0,2%) до исключительно высококачественной сборки 140,7 Мб. Д.melanogaster (contig N50 = 22,4 Мб, полнота BUSCO = 99,9%; рис. 2 и дополнительная таблица S1, дополнительные материалы онлайн). Для отрядов, представленных> 10 таксонами, скопления перепончатокрылых были наиболее полными (полнота BUSCO = 94%, SD = 14,3%), а чешуекрылые — наименьшими (74,6%, SD = 28,2%; рис. 2b). У Lepidoptera (15,3%) самый низкий процент долго читаемых сборок (дополнительный рис. S1, дополнительный материал онлайн), а сборки Heliconius были особенно фрагментированными (рис.1г). Для семейств, представленных более чем 10 таксонами, собрания Drosophilidae были наиболее полными (полнота BUSCO = 98.4%, SD = 2%), за ними следовали собрания Apidae (97.9%, SD = 3.7%; фиг. 1d и 2b). Как и ожидалось, сборки с более высокими длинами контигов N50 также были более полными (фиг. 2f), но размер сборки практически не влиял на полноту гена (дополнительный рисунок S3, дополнительный материал онлайн).

    Рис. 2.

    Различия в размере сборки и полноте гена BUSCO у Insecta.( a ) Размер сборки для всех насекомых, сгруппированных по порядку, а затем по семействам. Для улучшения визуализации был установлен верхний предел отображения 2,8 Гб. Четыре сборки генома превысили это значение и помечены серым текстом (в Гб). Силуэты таксонов были либо сделаны вручную, либо взяты из PhyloPic (http://phylopic.org, последний доступ 15 июля 2021 г.) ( b ) Результаты BUSCO для каждой сборки генома насекомого. Каждая горизонтальная полоса представляет одну сборку ( n = ) 601 вид) и соответствует тому же таксону на графике размеров сборки слева в ( a ).( c e ) Сравнение сборки генома с длинным и коротким чтением ( c ) полных BUSCO (единичные и дублированные комбинированные), ( d ) фрагментированных BUSCO и ( e ) дублированных BUSCO Только. Значимость оценивалась с помощью тестов Уэлча t . ( f ) Сравнение полноты BUSCO и контига N50. Каждая точка представляет собой наилучшую доступную совокупность для одного таксона, а группы таксонов одного и того же рода помечены черными кружками.Неудивительно, что более смежные сборки генома также демонстрируют большую полноту генов. ( г ) Более длинные гены с большей вероятностью будут фрагментированы в геномных сборках насекомых, независимо от используемой технологии. Тем не менее, существует гораздо более сильная корреляция между сборками короткого чтения и фрагментацией более длинных генов (р. Спирмена: 0,24, P < 2,2e-16), чем для сборок долгого чтения (р: 0,08 Спирмена, Р = 0,002). В отличие от ( c e ), каждый кружок в ( g ) представляет процент фрагментации для этого гена BUSCO во всех сборках с длинным или коротким чтением.Таким образом, каждый ген включается дважды (по одному разу для каждой технологии). Были использованы все 1367 генов BUSCO в наборе генов OrthoDB v.10 Insecta (Кривенцева и др., 2019), за исключением одного гена 2,02 kb, который отсутствовал в> 70% сборок и впоследствии был удален из анализа и визуализации. Длина гена BUSCO варьировала от 198 до 9,01 т.п.н.

    Рис. 2.

    Различия в размере сборки и полноте гена BUSCO у Insecta. ( a ) Размер сборки для всех насекомых, сгруппированных по порядку, а затем по семействам.Для улучшения визуализации был установлен верхний предел отображения 2,8 Гб. Четыре сборки генома превысили это значение и помечены серым текстом (в Гб). Силуэты таксонов были либо сделаны вручную, либо взяты из PhyloPic (http://phylopic.org, последний доступ 15 июля 2021 г.) ( b ) Результаты BUSCO для каждой сборки генома насекомого. Каждая горизонтальная полоса представляет одну сборку ( n = ) 601 вид) и соответствует тому же таксону на графике размеров сборки слева в ( a ).( c e ) Сравнение сборки генома с длинным и коротким чтением ( c ) полных BUSCO (единичные и дублированные комбинированные), ( d ) фрагментированных BUSCO и ( e ) дублированных BUSCO Только. Значимость оценивалась с помощью тестов Уэлча t . ( f ) Сравнение полноты BUSCO и контига N50. Каждая точка представляет собой наилучшую доступную совокупность для одного таксона, а группы таксонов одного и того же рода помечены черными кружками.Неудивительно, что более смежные сборки генома также демонстрируют большую полноту генов. ( г ) Более длинные гены с большей вероятностью будут фрагментированы в геномных сборках насекомых, независимо от используемой технологии. Тем не менее, существует гораздо более сильная корреляция между сборками короткого чтения и фрагментацией более длинных генов (р. Спирмена: 0,24, P < 2,2e-16), чем для сборок долгого чтения (р: 0,08 Спирмена, Р = 0,002). В отличие от ( c e ), каждый кружок в ( g ) представляет процент фрагментации для этого гена BUSCO во всех сборках с длинным или коротким чтением.Таким образом, каждый ген включается дважды (по одному разу для каждой технологии). Были использованы все 1367 генов BUSCO в наборе генов OrthoDB v.10 Insecta (Кривенцева и др., 2019), за исключением одного гена 2,02 kb, который отсутствовал в> 70% сборок и впоследствии был удален из анализа и визуализации. Длина гена BUSCO варьировала от 198 до 9,01 т.п.н.

    Тип (ы) данных о последовательности, используемых для сборки генома, был получен для ~ 82% сборок (длинное чтение = 126, короткое чтение = 365; дополнительная таблица S1, дополнительные материалы онлайн).Сборки с длительным считыванием были более смежными, чем сборки с коротким считыванием (рис.1b; P , Welch’s t -test <0,0001), при этом средние значения contig N50 были на ~ 4,4 Мбайт выше, несмотря на отсутствие разницы в размере сборки ( P , Welch’s t -test = 0,12; дополнительный рис. S4, дополнительные материалы онлайн). Области генов также были гораздо более полными в сборках с длинными считываниями (средняя полнота BUSCO = 96%, SD = 7%) по сравнению с областями, сгенерированными с помощью коротких считываний (89,1%, SD = 19%; P , тест Велча t ). <1e-8; рис.2c) с на 70% меньше фрагментированных генов ( P , Welch’s t -test <1e-11; рис. 2d). Однако сборки с длительным чтением имели в ~ 2,6 раза больше дублированных генов (4,4% против 1,7%; P , Welch’s t -test = 0,003; рис. 2e). Более длинные гены BUSCO также с большей вероятностью будут фрагментированы как при коротком чтении (р. Спирмена: 0,24, P < 2.2e-16), так и в сборках длинного чтения (р Спирмена: 0,08, Р = 0,002). ; рис. 2g), но вероятность их отсутствия в обоих генах была ниже по сравнению с более короткими генами (краткое прочтение: р Спирмена: -0.08, P = 0,002; длинное чтение: Spearman’s p: −0,18, P = 9,7e-12; дополнительный рис. S5, Дополнительные материалы онлайн).

    Скорость, с которой становятся доступными новые сборки генома насекомых, явно ускоряется (рис. 1c). Около 50% ( n = 292) наилучших доступных сборок насекомых были зарегистрированы в 2019–2020 годах (дополнительные таблицы S1 и S2, дополнительные материалы онлайн). Этот же период также является высшей точкой соприкосновения (средний контиг N50, 2019–2020 = 1.77 Мб; дополнительная таблица S2, Дополнительные материалы онлайн). Большая часть увеличения смежности была вызвана сборками с длительным чтением, частота которых выросла с 0% всех сборок в 2011–2012 годах до 36,1% в 2019–2020 годах. Смежность сборок с длинным считыванием также резко увеличилась в 2017 году (дополнительный рис. S6 и таблица S2, дополнительные материалы онлайн).

    Мы вступили в новую эру биологии генома насекомых. С 2019 года сборка генома нового вида депонируется в GenBank каждые 2 раза.3 дня. Эти новые сборки в среднем заметно более смежны, чем те, что были всего несколько лет назад. Продолжая разрабатывать эти ресурсы, мы предлагаем четыре рекомендации: во-первых, мы должны признать характер этих данных, ориентированных на сообщества, и стремиться к лучшей интеграции между исследовательскими группами и консорциумами с точки зрения обмена данными, передового опыта и таксономической направленности. Наблюдается прогресс в достижении этих целей (например, предложенная метрическая система для описания качества сборки генома с соответствующими эталонными стандартами от Earth BioGenome Project, Lewin et al.2018) и будет ускоряться по мере того, как все больше исследователей интегрируют эти стандарты в свои рабочие процессы. Во-вторых, новые усилия по упорядочиванию должны быть направлены на то, чтобы сбалансировать выборку, которая заполняет таксономические пробелы и улучшает существующие ресурсы, с целевой выборкой, мотивированной конкретными вопросами. Оба подхода ценны и не исключают друг друга. Первое — заполнение таксономических пробелов — имеет решающее значение для широкого понимания эволюции насекомых, самой разнообразной группы животных на Земле; тогда как последнее — целевое секвенирование на основе вопросов — имеет решающее значение для понимания конкретных аспектов биологии генома, на которые часто лучше всего ответить, используя плотную выборку конкретных групп.Важно отметить, что успех этой рекомендации будет частично зависеть от нашей первой рекомендации. Лучшая интеграция и коммуникация ограничат избыточность усилий, когда геном одного и того же вида секвенируется несколькими группами одновременно. В-третьих, мы поддерживаем результаты проекта «Геном позвоночных» (Rhie et al., 2021) — сборки с длительным считыванием гораздо более смежны, чем подходы с коротким считыванием — и рекомендуем, чтобы эти технологии были приняты учеными, занимающимися геномом насекомых. И, в-четвертых, по состоянию на 2019 год только 40% геномных сборок насекомых имели соответствующие аннотации генов в GenBank (Li et al.2019). Расширение и уточнение доступности аннотаций генов для насекомых приведет к соответствующему увеличению масштабов таксономических сравнений, которые возможны для многих анализов. Преодоление этой проблемы качества и доступности аннотаций можно разделить на два более конкретных требования: 1) по возможности, аннотации должны быть доступны вместе со сборками генома в GenBank или аналогичных публичных репозиториях и 2) исследователям следует рассмотреть возможность использования аннотаций, созданных NCBI Eukaryotic Genome Аннотационный конвейер (Thibaud-Nissen et al.2016), чтобы ограничить вариации, вносимые различными подходами к аннотациям, и максимизировать совместимость.

    Помимо разработки ресурсов, мы должны продолжать использовать этот набор данных для проведения новых исследований биологии и эволюции генома насекомых. Эти усилия начинают проявляться и приносят дивиденды. Например, 76 геномных сборок членистоногих были использованы для лучшего понимания 500 млн лет эволюции путем характеристики изменений в содержании генов и белков во временном и филогенетическом контексте, включая идентификацию новых семейств генов, которые возникли во время диверсификации, со связями с ключевыми адаптациями, включая бегство ( Thomas et al.2020). Точно так же исследование 195 геномов насекомых выявило большое разнообразие мобильных элементов у насекомых с различными уровнями сохранности в зависимости от филогенетического положения (Gilbert et al. 2021). При наличии в общедоступных хранилищах наборов геномов, представляющих более 600 таксонов и ~ 480 млн лет эволюции, возможности и перспективы исследования генома насекомых никогда не были такими большими. Хотя наше внимание было сосредоточено на насекомых, длинные чтения, вероятно, революционизируют науку о геноме практически во всех таксономических группах с неиспользованным геномным потенциалом, существующим в общедоступных хранилищах на Древе жизни.Появление сборок с длительным считыванием, в частности, будет стимулировать новое понимание ранее трудно охарактеризованных аспектов генома (например, структуры генома, сильно повторяющихся областей). Продолжая создавать, курировать и делать общедоступные геномные ресурсы, мы получим потрясающее понимание биологии и эволюции генома в широких филогенетических масштабах. Мы также создадим более инклюзивную и справедливую дисциплину, расширив доступ к ресурсам для ученых, участие которых исторически ограничивалось финансовыми или технологическими барьерами.

    Дополнительные материалы

    Дополнительные данные доступны на сайте Genome Biology and Evolution онлайн.

    Благодарности

    S.H. и J.L.K. были поддержаны наградой NSF (OPP-1

    5). J.H и S.U.P. были поддержаны LOEWE-Центром трансляционной геномики биоразнообразия, который финансировался Министерством высшего образования, исследований и искусств земли Гессен. J.S.S. был поддержан стипендией NSF для постдокторских исследований в области биологии (DBI-1811930) и премией NIH General Medical Sciences Award (R35GM119515), полученной А.М.Л.

    Доступность данных

    Данные, лежащие в основе этой статьи, доступны в дополнительном материале, в основном в дополнительной таблице S1, со связанными скриптами для анализа на GitHub: https://github.com/pbfrandsen/insect_genome_assemblies.

    Цитированная литература

    Адамс

    MD

    и др.

    2000

    .

    Последовательность генома Drosophila melanogaster

    .

    Наука

    287

    :

    2185

    2195

    .

    Amarasinghe

    SL

    и др.

    2020

    .

    Возможности и проблемы анализа длинночитаемых данных секвенирования

    .

    Биология генома

    .

    21

    (

    1

    ):

    30

    .

    Bellinger

    PF

    ,

    Christiansen

    KA

    ,

    Janssens

    F.

    2020

    . Контрольный список Коллембол мира.Доступно по адресу: http://www.collembola.org.

    Collins

    FS

    ,

    Morgan

    M

    ,

    Patrinos

    A.

    2003

    .

    Проект «Геном человека»: уроки крупномасштабной биологии

    .

    Наука

    300

    (

    5617

    ):

    286

    290

    .

    Консорциум AgG

    .

    2017 г.

    .

    Генетическое разнообразие африканского переносчика малярии Anopheles gambiae

    .

    Природа

    552

    :

    96

    .

    Gilbert

    C

    ,

    Peccoud

    J

    ,

    Cordaux

    R.

    2021

    .

    Мобильные элементы и эволюция насекомых

    .

    Анну Рев Энтомол

    .

    66

    (

    1

    ):

    355

    372

    .

    Hotaling

    S

    ,

    Kelley

    JL

    ,

    Frandsen

    PB.

    2020

    .

    Водные насекомые крайне недопредставлены в геномных исследованиях

    .

    Насекомые

    11

    (

    9

    ):

    601

    .

    Hug

    LA

    и др.

    2016

    .

    Новый взгляд на древо жизни

    .

    Нат Микробиол

    .

    1

    (

    5

    ):

    1

    6

    .

    Консорциум i5K

    .

    2013

    .

    Инициатива i5K: развитие геномики членистоногих на благо знаний, здоровья человека, сельского хозяйства и окружающей среды

    .

    Дж. Наследие

    .

    104

    :

    595

    600

    .

    Келли

    JL

    и др.

    2014

    .

    Компактный геном антарктической мошки, вероятно, является адаптацией к экстремальным условиям

    .

    Нац Коммуна

    .

    5

    :

    4611

    .

    Кривенцева

    ЭВ

    и др.

    2019

    .

    OrthoDB v10: выборка разнообразных геномов животных, растений, грибов, протистов, бактерий и вирусов для эволюционной и функциональной аннотации ортологов

    .

    Nucleic Acids Res

    .

    47

    (

    D1

    ):

    D807

    D811

    .

    Левин

    HA

    , et al.

    2018

    .

    Earth BioGenome Project: определение последовательности жизни для будущего жизни

    .

    Proc Natl Acad Sci U S A

    .

    115

    (

    17

    ):

    4325

    4333

    .

    Li

    F

    и др.

    2019

    .

    Геномы насекомых: успехи и проблемы

    .

    Насекомое Мол Биол

    .

    28

    (

    6

    ):

    739

    758

    .

    McGee

    MD

    и др.

    2020

    .

    Экологические и геномные основы взрывной адаптивной радиации

    .

    Природа

    586

    (

    7827

    ):

    75

    79

    .

    McKenna

    DD

    и др.

    2019

    .

    Эволюция и геномные основы разнообразия жуков

    .

    Proc Natl Acad Sci U S A

    .

    116

    (

    49

    ):

    24729

    24737

    .

    Misof

    B

    и др.

    2014

    .

    Филогеномика определяет время и закономерность эволюции насекомых

    .

    Наука

    346

    (

    6210

    ):

    763

    767

    .

    Петерсен

    M

    , et al.

    2019

    .

    Разнообразие и эволюция репертуара мобильных элементов у членистоногих с особым упором на насекомых

    .

    БМС Эвол Биол

    .

    19

    (

    1

    ):

    1

    15

    .

    Ри

    A

    и др.

    2021

    .

    На пути к полному и безошибочному построению генома всех видов позвоночных

    .

    Природа

    592

    (

    7856

    ):

    737

    746

    .

    Робинсон

    GE

    и др.

    2011

    .

    Создание шума о геномах насекомых

    .

    Наука

    331

    (

    6023

    ):

    1386

    .

    Sayers

    EW

    , et al.

    2021

    .

    Генбанк

    .

    Nucleic Acids Res

    .

    48

    :

    D84

    D86

    .

    Seehausen

    O

    , et al.

    2014

    .

    Геномика и происхождение видов

    .

    Нат Рев Генет

    .

    15

    (

    3

    ):

    176

    192

    .

    Seppey

    M

    ,

    Manni

    M

    ,

    Zdobnov

    EM.

    2019

    . BUSCO: оценка сборки генома и полноты аннотации. В:

    Генное предсказание: методы молекулярной биологии

    .

    Нью-Йорк (Нью-Йорк): Humana

    . п.

    227

    245

    .

    Аист

    NE.

    2018

    .

    Сколько видов насекомых и других наземных членистоногих существует на Земле?

    Анну Рев Энтомол

    .

    63

    :

    31

    45

    .

    Thibaud-Nissen

    F

    , et al.

    2016

    .

    Конвейер аннотации эукариотического генома NCBI

    .

    J Anim Sci

    .

    94

    (Дополнение 4):

    184

    184

    .

    Thomas

    GW

    , et al.

    2020

    .

    Эволюция генного состава у членистоногих

    .

    Биология генома

    .

    21

    (

    1

    ):

    1

    14

    .

    Ван

    X

    и др.

    2014

    .

    Геном саранчи дает представление об образовании роя и дальних перелетах

    .

    Нац Коммуна

    .

    5

    (

    1

    ):

    1

    9

    .

    Чжан

    Z-Q.

    2011

    .

    Биоразнообразие животных: план классификации более высокого уровня и обзор таксономического богатства

    .

    Waco (Техас)

    :

    Magnolia Press

    .

    © Автор (ы) 2021. Опубликовано Oxford University Press от имени Общества молекулярной биологии и эволюции.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http: // creativecommons.org / licenses / by / 4.0 /), что разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

    Сборка хромосом кукурузы без зазоров с использованием технологий длительного считывания | Genome Biology

    Сборка PacBio

    ДНК с высоким молекулярным весом экстрагировали из молодых листьев, используя протокол Дойла и Дойла [23] с небольшими модификациями. Молодые листья кукурузы быстро замораживали при -80 ° C, измельчали ​​до мелкого порошка в жидком N2 с последующей очень осторожной экстракцией в буфере CTAB (который включал протеиназу K, PVP-40 и бета-меркаптоэтанол) в течение 1 часа при 50 ° C.После центрифугирования супернатант дважды осторожно экстрагировали смесью хлороформ: изоамиловый спирт 24: 1. Верхнюю фазу доводили до 1/10 объема 3 М KAc, осторожно перемешивали и осаждали ДНК изопропанолом. ДНК собирали центрифугированием, промывали 70% EtOH, сушили на воздухе в течение 20 мин и тщательно растворяли в 1 × TE при комнатной температуре.

    Библиотеки секвенирования

    были сконструированы в соответствии с протоколами подготовки шаблонов PacBio (Процедура и контрольный список — Подготовка библиотек гДНК с использованием SMRTbell Express Template Preparation Kit 2.0, PN 101-693-800, версия 01) для Express Template Prep Kit 2.0 (№ по каталогу 100-939-900) и секвенировали с использованием Sequel SMRTLink V5.1 и Sequel связывания и секвенирования v2.1. Самые длинные 50-кратные из 62-кратных необработанных последовательностей PacBio были исправлены с использованием конвейера falcon_kit v0.7 [24] без повторного маскирования с помощью TANmask и REPmask (-e 0,75 -l 3000 —min_cov 2 —max_n_read 200). Чтения с исправлением ошибок (43X, N50 = 22,3 Кб) затем были обрезаны и собраны с помощью Canu [13] (v1.8) со следующими параметрами: correctedErrorRate = 0.065 corMhapSensitivity = нормальный ovlMerThreshold = 500 utgOvlMerThreshold = 150. Процесс исправления ошибок чтения, необходимый для сборки PacBio, мог привести к гомогенизации некоторых повторов и ограничить сборку в областях с длинными повторами. Точность контигов, сгенерированных Canu, была увеличена за счет выравнивания необработанных чтений PacBio со сборкой с использованием pbmm2 (v1.2.0) из pb-assembly [24] и запуска инструмента консенсусного алгоритма PacBio Arrow (v2.3.3) (https: / /github.com/PacificBiosciences/GenomicConsensus) с параметрами по умолчанию для создания секвенированных полированных контигов.Сборка контигов была дополнительно отполирована с использованием последовательности 73X PE150 Illumina, сначала путем совмещения считываний с полированной сборкой Arrow с помощью minimap2 [25], с последующим запуском сборочного инструмента Pilon [26] (v1.22) для исправления отдельных базовых ошибок и небольших отступов. с использованием следующих параметров: —fix оснований —minmq 30.

    Сборка нанопор

    Два различных метода экстракции ДНК были использованы для создания ДНК с высокой молекулярной массой (HMW) для секвенирования Oxford Nanopore (ONT). ДНК CTAB получали, как описано выше для сборки PacBio.Ядерная ДНК была приготовлена ​​по протоколу Луо и Винга [27] с небольшими модификациями. Молодые листья мгновенно замораживали при -80 ° C, измельчали ​​в жидком азоте и инкубировали с буфером NIB (10 мМ Tris-HCL, PH8.0, 10 мМ EDTA PH8.0, 100 мМ KCL, 0,5 M сахароза, 4 мМ спермидин, 1 мМ спермина) на льду в течение 15 мин. После фильтрации через чудо-ткань Triton X-100 (Sigma) добавляли в пробирки в соотношении 1:20, помещали на лед на 15 мин и центрифугировали для сбора ядер. Ядра промывали буфером NIB (содержащим Triton X-100), ресуспендировали в 40 мл того же буфера и снова центрифугировали.После удаления всей жидкости добавляли 10 мл буфера Qiagen G2 с последующей осторожной ресуспендированием ядер; затем добавляли 30 мл буфера G2 с РНКазой A (до конечной концентрации 50 мг / мл). Пробирки инкубировали при 37 ° C в течение 30 мин. Добавляли 30 мг протеиназы K (Invitrogen) и инкубировали при 50 ° C в течение 2 часов с последующим центрифугированием в течение 15 минут при 8000 об / мин при 4 ° C, и жидкость осторожно переливали в новую пробирку. После осторожной экстракции смесью хлороформ: изоамиловый спирт (24: 1) ДНК осаждали изопропанолом двумя третями объема.Осадок ДНК промывали 70% EtOH, сушили на воздухе в течение 20 мин и растворяли в ТЕ при комнатной температуре.

    ДНК

    как из CTAB, так и из ядерного препарата использовали для создания библиотеки быстрого (SQK-RAD004) или одномерного (1D; SQK-LSK109) секвенирования для ONT. Полученные библиотеки запускали на секвенсоре MinION или GridION, работающем в течение 48 часов. Все базы были вызваны в GridION с использованием Guppy (v2.1.3), и полученные файлы fastq использовались для сборки генома. Всего 121 ГБ (~ 50 ×) последовательности ONT было сгенерировано с помощью 27 MinION R9.4 проточные ячейки. Данные были отфильтрованы для считываний> 10 КБ с использованием seqtk (https://github.com/lh4/seqtk), что привело к примерно 30-кратному охвату (N50 = 29 311 п.н.) генома кукурузы. Полученные в результате нескорректированные чтения были выровнены (перекрыты) с помощью minimap2 (v2.13; -x ava-ont -t 64) [25], а граф сборки (макет) был сгенерирован с помощью miniasm (v0.3; -f <перекрытия>) [14]. Полученный график был проверен с помощью Bandage [28]. Тот факт, что сборка Nanopore проводилась с нескорректированными считываниями, возможно, способствовал его лучшей производительности в длинных повторяющихся областях (дополнительный файл 1: рис.S2). Консенсусную сборку генома генерировали путем сопоставления считываний размером> 10 КБ с сборкой с помощью minimap2 и последующего запуска racon (v1.3.1) [29]; процесс консенсуса был повторен трижды. Сборка контигов была дополнительно отполирована с использованием последовательности 73X PE150 Illumina путем первого выравнивания считываний с консенсусной сборкой с использованием minimap2 [14] с последующим запуском сборочного инструмента Pilon (v1.18) [26] два раза с использованием последовательности 73X PE150 Illumina.

    Сборка оптических карт

    ДНК сверхвысокой молекулярной массы была выделена из проростков кукурузы с использованием модифицированной версии протокола Bionano Genomics Plant Tissue DNA Isolation Base.Приблизительно 0,5 г здоровой надземной ткани было собрано из молодых этиолированных проростков B73-Ab10, выращенных в безпочвенных условиях в течение 2 недель. Листья обрабатывали 2% -ным фиксирующим раствором формальдегида Bionano, промывали, измельчали ​​и гомогенизировали с использованием Qiagen TissueRuptor в буфере для гомогенизации. Свободные ядра осаждали при 2000 × г , промывали, выделяли градиентным центрифугированием и заключали в пробку из агарозы с низкой температурой плавления. Ядра лизировали обработкой протеиназой К и РНКазой А, как описано ранее [30], и промывали четыре раза в буфере для промывки и пять раз в буфере ТЕ.Очищенную высокомолекулярную ядерную ДНК выделяли путем плавления пробки, ее переваривания агаразой и проведения диализа против ТЕ.

    Платформа Bionano Saphyr была использована в сочетании с процессом Direct Label and Stain (DLS) для создания каркасов последовательностей на уровне хромосом [31]. Прямое мечение проводили с использованием набора для прямого мечения и окрашивания (Bionano Genomics, Сан-Диего, Калифорния) в соответствии с протоколом производителя, за исключением того, что использовали 1 мкг ДНК и добавляли краситель ДНК до конечной концентрации 1 мкл на 0.1 мкг конечной ДНК. Меченый образец загружали в чип Saphyr, и молекулы разделяли, отображали и оцифровывали с помощью сервера Saphyr and Compute. Визуализацию данных, сборку карт и создание гибридных каркасов выполняли с использованием Bionano Access (v1.3) и Bionano Solve (v3.4.0). Подмножество из 1 580 077 молекул с минимальным размером 150 Кб и комбинированной длиной 424 488 Мб было собрано без предварительной сборки с использованием параметров без гаплотипа, без CMPR-вырезания без удлинения-расщепления.

    Объединение сборок и закрытие зазоров

    Мы разработали конвейер для интеграции независимых сборок контигов и исправления ошибок сборки с использованием карт Bionano в качестве привязки.Конвейер состоит из пяти этапов: (1) разрешение конфликтов, (2) исправление ошибок сборки, (3) слияние контигов, (4) гибридная сборка и удаление перекрытия контигов и (5) ручное исправление и заполнение пробелов (дополнительный файл 1: Рис. S1). Первые четыре шага были автоматизированы. При слиянии контигов на третьем этапе была образована хромосома 3 без зазоров, а полная сборка хромосомы 9 требовала ручного лечения. Хотя слияние контигов с миниазмом может применяться к любым двум сборкам последовательностей, наличие собранных de novo карт Bionano необходимо для выполнения устранения конфликтов на шаге 1, исправления ошибок контигов на шаге 2 и гибридного каркаса на шаге 4 конвейера.

    • Шаг 1: Конфликты между оптической картой и сборками последовательностей ДНК были разрешены с помощью программного обеспечения Bionano Solve (https://bionanogenomics.com/support-page/data-analysis-documentation/). Сборка последовательностей может иногда соединять две области, которые разделяют повторяющуюся последовательность, но не принадлежат друг другу (образуя химерный контиг). Они проявляются как конфликты между картами Bionano и сборками последовательностей, когда они выровнены. Оптические карты были сопоставлены с in silico переваренными представлениями сборок последовательностей ДНК с использованием RefAligner (v3.4.0) и конфликты, выявленные с помощью сценария AssignAlignType.pl. Конфликты с химерным показателем качества выше порога по умолчанию были разделены с помощью cut_conflicts.pl (с использованием параметров по умолчанию из optArguments_nonhaplotype_noES_DLE1_saphyr.xml), а файл последовательности был создан с помощью специального сценария cut_conflict_NGS.py. Удаление химерных объединений увеличивает вероятность слияния дополнительных контигов на шаге 3.

    • Шаг 2. Ошибки сборки в контигах PacBio с разрешенным конфликтом были обнаружены и автоматически обработаны с помощью контигов ONT.На этом этапе контиги PacBio и ONT были согласованы с измененными оптическими картами и структурными несоответствиями, обнаруженными с помощью конвейера вызова структурных вариантов из BionanoSolve (v3.4.0). Гомозиготные вставки и делеции с достоверностью не менее 0,1 и размером более 1 Кб были классифицированы как истинные ошибки сборки в контигах PacBio. При условии, что не было обнаружено структурных несоответствий в соответствующих контигах ONT, контиги ONT использовались для замены ошибочных последовательностей в контигах PacBio с использованием настраиваемого скрипта SV_fix.ру.

    • Шаг 3. Контиги ONT использовались для закрытия пробелов и улучшения непрерывности сборки контигов PacBio. Контиги ONT были сопоставлены контигам PacBio с помощью minimap2 [25] (v2.13; -k28 -w28 -A1 -B9 -O16,41 -E2,1 -z200 -g100000 -r100000 —max-chain-skip 100), и перекрывающиеся области объединены с помощью miniasm [14] (v0.3; -1-2 -r0 -e1 -n1 -h350000 -g100000 -o25000). На этом этапе создаются гибридные контиги PacBio / ONT, которые называются единичными.Затем блоки были объединены с оставшимися контигами из основной сборки PacBio, чтобы создать объединенную сборку контигов. После этого шага была сгенерирована хромосома 3 без зазоров (автоматически разрешилась область гетерозиготности от 164,5 до 166,2 МБ на хромосоме 3). Затем объединенные контиги были выровнены с картами Bionano, на которых были обнаружены перекрытия между соседними контигами и объединены с minimap2 (v2.13) и miniasm (v0.3) с помощью специального скрипта Overlap_merge.py. Этот шаг определяет только большие перекрытия (примерно> 200 Кб), которые могут быть обнаружены на уровне выравнивания меток de novo Bionano.Выявление всех перекрытий, в том числе меньших перекрытий, требует гибридного каркаса с оптической картой (шаг 4). При переходе к шагу 4 объединение с перекрытием на шаге 3 является необязательным.

    • Шаг 4: карты Bionano были интегрированы с контигами последовательностей с помощью гибридного каркаса с использованием сценария hybridScaffold.pl из BionanoSolve (v3.4.0) с параметрами по умолчанию из optArguments_nonhaplotype_noES_DLE1_saphyr.xml. Этот шаг упорядочивает и ориентирует контиги последовательности и способствует устранению оставшихся перекрытий между контигами.Поскольку оптические карты выравниваются и повторно масштабируются с картами последовательностей многократно во время гибридного каркаса, более точные перекрытия между контигами идентифицируются и аннотируются как 13N промежутки. Эти перекрытия были удалены посредством слияния контигов с миниазмом (v0.3), как описано в шаге 3. Из-за крайней повторяемости в области повтора 45S рДНК на хромосоме 6 как сборки контигов, так и гибридные каркасы в этой области ошибочны. Поэтому мы оставили контиги в NOR не объединенными и отметили некорректность 13N пробелами.

    • Шаг 5: Ручное курирование выполняли для исправления ошибок сборки, закрытия пробелов в повторяющихся и гетерозиготных областях и сборки теломер.

      Повторное руководство по сборке . В очень повторяющихся регионах ошибочные соединения чтения на концах контигов не были обнаружены как конфликты или ошибки сборки на шагах 1 или 2 из-за ограниченного разрешения выравнивания Bionano. В этих регионах мы обрезали и удалили невыровненные области, чтобы выявить подходящие концы для слияния с перекрытием, используя miniasm (v0.3). Эти модификации увеличили смежность повторяющихся массивов на краях более длинных контигов. Контиги, состоящие исключительно из наборов узлов и повторов CentC, лишены пангеномных якорных маркеров и отсутствуют в псевдомолекулах.

      Обработка хромосомы 9 вручную . В сборке хромосомы 9 после гибридного каркаса присутствовало семь пробелов размером от 2 до 236 кб. Два больших пропуска размером 236 Кбайт и 41 Кбайт были вызваны гетерозиготностью (76,29–76,80 Мбайт), один пропуск 21 Кбайт был обусловлен повторяемостью в массиве CentC (58.43–58,67 Мбайт), а оставшиеся четыре промежутка были меньше 7 Кбайт (два из них были в ручке 843-Кбайт на кончике 9S). Четыре небольших пробела были сначала заполнены запуском трех итераций LR Gapcloser (24 сентября 2018 г., фиксация) [32] с настройками по умолчанию с использованием операций чтения с исправленными ошибками PacBio. Чтобы устранить разрыв размером 236 Кб, вызванный гетерозиготностью, все контиги, заякоренные на хромосоме 9, были повторно скаффолдинги, используя самую длинную карту Бионано хромосомы 9 в качестве единственного якоря. Это уменьшило разрыв в 236 Кбайт до 58 Кбайт. Локальные сборки запускались с помощью Flye (v2.6) [33] с помощью ONT считывает окружающие пропуски, чтобы заполнить оставшиеся пропуски размером 58 и 41 Кбайт. Контиги, собранные на лету, были интегрированы с фланговыми контигами путем юнитигинга с помощью miniasm (v0.3) и выровнены по картам Bionano для проверки. Остался пробел в 8 Кбайт, который был заполнен одним охватывающим его считыванием ONT. Пробел в массиве CentC был заполнен путем ручного выбора двух длинных считываний ONT (> 50 КБ), охватывающих пробел, создания консенсуса при перекрытии и помещения полученной последовательности в пробел.

      Киндр комплекс ручного курирования . Сборка по тандемному массиву ~ 1 Mb генов Kindr (каждый в пределах ~ 100-Kb повтора) была ошибочной из-за коллапса контига последовательности PacBio и неправильного каркаса. Мы вручную выбрали наиболее смежный контиг ONT в этой области, выполнили гибридные каркасы для каркаса, содержащего Kindr , поместили исключенный контиг в правильную область и удалили область перекрытия посредством слияния контигов.

      Ручная обработка теломер . Пятнадцать теломер были собраны путем удлинения концов каркасов с помощью самого длинного однозначно картированного чтения ONT, которое содержало теломерные повторы TTTAGGG / CCCTAAA (≥ 1 Kb). Области с недавно собранными теломерами включают 1L, 2L, 3S, 3L, 4S, 4L, 5L, 6L, 7S, 7L, 8S, 8L, 9S, 9L и 10S.

    Окончательные каркасы были отполированы с помощью субрезов PacBio с использованием инструментов из pb-assembly [24].Выравнивание чтения выполнялось с помощью pbmm2 (v1.2.0), а полировка выполнялась с помощью GCpp (v1.0.0) с параметрами по умолчанию. Каркасы были дополнительно отполированы с помощью считывателей 73X PE150 Illumina с использованием Pilon (v1.23) с параметрами по умолчанию [26]. Считывает PacBio с исправленными ошибками, а считывание Illumina часто неправильно отображается в очень повторяющихся областях (Дополнительный файл 1: Рис. S2B, C, D). Ожидается, что области с чрезмерно неправильным отображением будут чрезмерно полированы, тогда как области с небольшим количеством правильно отображенных считываний, как ожидается, сохранят более высокую частоту ошибок секвенирования.

    Конструкция AGP

    Псевдомолекулы были сконструированы из гибридных каркасов с использованием ALLMAPS (v0.8.12) [34]. Оба пан-геномных якорных маркера [35] и генетическая карта IBM (Intermated B73 × Mo17) [36] были использованы с равными весами для упорядочивания и ориентации каркасов. Якорные маркеры пан-генома были получены из сообщества CyVerse Data [37] и обработаны для создания файла ложа с 50 п.н. выше и ниже координат B73 V3. Извлеченные маркеры были сопоставлены с HiSat2 (v2.1.0) 29,30 индексируемая сборка B73-Ab10 путем отключения сплайсинга (—no-spliced-alignment) и принудительного глобального выравнивания (—end-to-end). Очень высокие штрафы за открытие и расширение пропусков чтения и ссылок (—rdg 10000,10000 и —rfg 10000,10000) также использовались для обеспечения полноразмерного отображения последовательности маркеров. Затем окончательное выравнивание было отфильтровано для обеспечения качества сопоставления более 30 и тега XM: 0 (уникальное сопоставление), чтобы сохранить только высококачественные, однозначно сопоставленные последовательности маркеров. Сопоставленные маркеры были объединены с прогнозируемой информацией о расстоянии для создания входного файла CSV для ALLMAPS.Для конструирования псевдомолекул использовали только каркасы с более чем 20 уникально картированными маркерами, максимум 100 маркеров на каркас. Генетические маркеры IBM были загружены из MaizeGDB (https://www.maizegdb.org/complete_map?id=887740) [38] и были обработаны для создания файла кровати, аналогичного пангеномным маркерам. Для маркеров с координатами из генома B73 v4 были выделены фланкирующие области длиной 50 п.н. Для маркеров без координат последовательности маркеров использовались как есть, а те, в которых отсутствовали как координаты, так и последовательности, отбрасывались.Картирование маркеров было выполнено аналогично методу, описанному выше для якорных маркеров пангенома, с сохранением всех однозначно картированных маркеров. Информация о генетическом расстоянии для этих маркеров была преобразована в файл CSV перед использованием в ALLMAPS. ALLMAPS был запущен с параметрами по умолчанию, и псевдомолекулы были окончательно определены после проверки графика размещения маркеров и направлений каркаса. Из 50 каркасов Bionano, закрепленных контигами последовательностей, 26 с уникально картированными генетическими маркерами были включены в псевдомолекулы.Из 24 неразмещенных строительных лесов общим размером 19,4 МБ 22 полностью состоят из массивов knob180 и / или TR-1 (17,7 МБ).

    Сравнение сборок PacBio и Nanopore в повторяющихся и гетерозиготных областях

    Чтобы определить, как тандемные повторы и регионы гетерозиготности влияют на сборки, мы идентифицировали тандемно повторяющиеся области путем самовыравнивания хромосомы с помощью Minimap2 (v2.17; -PD -k19 -w19 -m200) и гетерозиготные области путем ручной проверки с использованием программного обеспечения Bionano Access.Координаты зазора PacBio проецировались на окончательную сборку с помощью minimap2 (v2.17; -cx asm5 —cs), за которым следовало изменение координат с помощью paftools.js [25]. Пробелы, которые были дополнены контигами Nanopore, были идентифицированы как пробелы, присутствующие в сборке PacBio, но отсутствующие в окончательной сборке. Скорректированные в PacBio координаты промежутков, дополненные промежутки и промежутки окончательной сборки были сопоставлены с тандемными повторами и гетерозиготными регионами с помощью bedtools [39] (v2.28.0; window -r 500000 -l 500000). Сочетание пропусков PacBio с тандемной повторяемостью и гетерозиготными регионами оценивали с помощью двустороннего точного теста Фишера с использованием программных средств Fisher (v2.28.0) с настройками по умолчанию.

    Для оценки охвата считыванием областей пропусков в итоговую сборку были сопоставлены в общей сложности 36,9-кратные считывания PacBio с исправленными ошибками (≥ 10 Кб), 20,7-кратные считывания с исправленными ошибками (≥ 10 КБ) и 30-кратные считывания PE150 Illumina. . Отображение длинного чтения выполнялось с помощью minimap2 (v2.17) с параметрами по умолчанию, а отображение короткого чтения выполнялось с помощью bwa (v0.7.17) с настройками по умолчанию. Области разрыва чтения были определены как области, отображаемые с менее чем 3 считываниями для наборов данных PacBio и Illumina и менее чем с 2 считываниями для набора данных Oxford Nanopore.Покрытие генома на уровне пар оснований было рассчитано с помощью bedtools genomecov (v2.28.0; -bga), и были извлечены области с меньшим количеством считываний, чем пороговое значение. Распределение длин считываний PacBio и Oxford Nanopore, отображаемых на тандемный повтор (chr8: 31–33,5 МБ) и гетерозиготную область (chr3: 164–167,6 МБ), были получены с помощью SAMTools (v1.9).

    RNA-seq

    В ходе разработки были отобраны образцы из десяти тканей для обоснованной аннотации генов, включая следующее: (1) первичный корень и (2) колеоптиль через 6 дней после посадки; (3) основание 10-го листа, (4) середина 10-го листа и (5) верхушка 10-го листа на стадии роста Vegetative 11 (V11); (6) мейотическая кисточка и (7) незрелый колос на стадии роста V18; 8 — пыльники на стадии роста Reproductive 1 (R1); и (9) эндосперм и (10) эмбрион через 16 дней после опыления.Для каждой ткани были собраны две биологические копии, и каждая биологическая копия состояла из ткани трех отдельных растений. Ткани эндосперма и зародыша собирали с 50 зерен на растение (всего 150 зерен на биологическую повторность). Ткани 1–5, указанные выше, были собраны с растений, выращенных в теплице, а ткани 6–10 — с растений, выращенных в поле. Выращенные в теплице растения высаживали в Metro-Mix300 (Sun Gro Horticulture) без дополнительных удобрений и выращивали в тепличных условиях (27 ° C / 24 ° C день / ночь и 16 часов / 8 часов свет / темнота) в Университете Миннесоты. Помещения для выращивания растений.Полевые растения были посажены на Сельскохозяйственной экспериментальной станции Миннесоты, расположенной в Сент-Поле, Миннесота, с 30-дюймовой посадкой. междурядье ~ 52 000 растений на гектар. РНК экстрагировали с использованием мини-набора для растений Qiagen RNeasy в соответствии с протоколом, предложенным производителем.

    Образцы общей РНК были проанализированы с помощью биоанализатора для определения целостности РНК и нормализованы в 25 мкл воды, свободной от нуклеаз, перед приготовлением библиотеки. Библиотеки секвенирования получали с использованием набора Stranded mRNA-seq KAPA (# KK4821) в соответствии с инструкциями производителя.МРНК обогащали с использованием гранул олиго-dT, фрагментировали и превращали в двухцепочечную кДНК с использованием случайного праймирования гексамеров и амплификации. Библиотеки объединяли в эквимолярных соотношениях и секвенировали на приборах NextSeq 500 с использованием протокола PE75.

    Аннотации гена

    Для предсказаний, основанных на фактах, сборки транскриптов на основе генома были созданы из пяти различных ассемблеров, а именно Trinity (v2.6.6) [40, 41], StringTie (v1.3.4a) [42], Strawberry (v1.1.1) [43], Запонки (v2.2.1) [42, 44] и Class2 [42, 44, 45], а лучший набор транскриптов был идентифицирован и аннотирован как гены с использованием Mikado (v1.2.4) [46]. Вкратце, чтения RNA-seq из каждой библиотеки были сопоставлены с геномом B73-Ab10, индексированным STAR (v2.5.3a) [47], с использованием подхода 2-проходного картирования (начальный этап выравнивания предоставляет информацию о сплайсинге для последующего цикла отображение читает). Параметры по умолчанию использовались для сопоставления с несколькими включенными параметрами пост-обработки (распечатать все атрибуты формата SAM —outSAMattributes All; совместимость с нисходящим потоком —outSAMmapqUnique 10; и количество несовпадений —outFilterMismatchNmax 0).Затем индивидуально отображенные библиотеки RNA-seq были объединены, отсортированы и проиндексированы с помощью SAMTools (v1.9) [48] для использования с программами сборки транскриптов. Для всех ассемблеров транскриптомов, управляемых геномом, использовались параметры по умолчанию, за исключением того, что если разрешена минимальная длина транскрипта, она была установлена ​​на 100 п.н. (Trinity с использованием —min_contig_length 100, StringTie с использованием -m 100 и Strawberry с использованием -t 100), и если он допускал многожильность RNAseq, он был установлен на многожильный (Trinity с использованием -SS_lib_type FR, Cufflinks с использованием —library-type fr-firststrand).Для Trinity максимальный размер интрона также был установлен равным 10 000 (—genome_guided_max_intron 10000). Все ассемблеры сгенерировали GFF3 в качестве окончательного вывода, за исключением Trinity, для которого собранные транскрипты в формате fasta были отображены обратно в индексированный геном gmap (v2019-05-12) для создания файла GFF3 (путем установки для параметра формата вывода -f значения gff3_match_cdna). Portcullis (v1.1.2) [49] был использован для создания набора с высокой степенью достоверности сплайсинговых соединений для генома B73-Ab10 из объединенных картированных считываний. Mikado был настроен на использование всех сборок транскриптов (с неразветвленностью, помеченной как True для всех, кроме Trinity, и с равным весом), сайтов сплайсинга, генерируемых решеткой, и растений.скоринговая матрица yaml. Предварительные транскрипты, подготовленные Mikado путем объединения всех транскриптов и удаления избыточных копий, были обработаны с помощью TransDecoder (v5.5.0) [50] (для идентификации открытых рамок считывания) и blastx (v2.9.0) [40] против белков SwissProt viridiplantae ( для идентификации полноразмерных стенограмм). Для TransDecoder использовались параметры по умолчанию, а для blastx максимальное количество целевых последовательностей было установлено равным 5 (-max_target_seqs 5), а формат вывода — xml (-outfmt 5). Они были предоставлены Микадо в качестве исходных данных для выбора и аннотирования лучших транскриптов для каждого локуса.Полученный файл GFF3 был использован для извлечения транскриптов и белков с помощью утилиты gffread из пакета Cufflinks.

    Дополнительные структурные улучшения транскриптов, сгенерированных Mikado, были выполнены с использованием инструмента аннотации генома PASA (v2.3.3) [51]. Входные данные для PASA включали 2 019 896 EST кукурузы, полученных из генбанка, 83 087 транскриптов Mikado, 69 163 полноразмерных кДНК B73 из генбанка и 46 311 транскриптов iso-seq кукурузы из 11 тканей развития, которые были отфильтрованы для удержания интронов [52].PASA был запущен с параметрами по умолчанию, с первым этапом сопоставления свидетельств транскрипции с замаскированным геномом B73-Ab10 с использованием GMAP (v.2018-07-04) [53] и Blat (v.36) [54]. Идентификаторы полноразмерной кДНК и Iso-seq транскриптов были переданы в текстовом файле (-f FL.acc.list) на этапе выравнивания PASA. Достоверные почти идеальные выравнивания с 95% идентичностью были сгруппированы на основе местоположения картирования генома и собраны в генные структуры, которые включали максимальное количество совместимых выравниваний транскриптов. Затем сборки PASA сравнивали с моделями транскриптов B73-Ab10 Mikado с использованием параметров по умолчанию.PASA обновила модели, предоставив расширения UTR, новые и дополнительные альтернативные изоформы. Сгенерированные PASA модели были пропущены через конвейер аннотаций MAKER-P (v3.0) [55] как model_gff вместе со всеми последовательностями транскриптов и белков для получения баллов Annotation Edit Distance (AED) [56] для оценки качества аннотаций. Гены, связанные с транспозонным элементом (TE), были отфильтрованы с помощью инструмента TEsorter [40, 57], который использует базу данных TE REXdb (viridiplantae_v3.0 + metazoa_v3). Наконец, аннотации генов были проверены на наличие ошибок трансляции с помощью конвейера EnsemblCompara [58].

    Оценка BUSCO

    Полнота генного пространства сборки генома B73-Ab10 была оценена с помощью инструмента GenomeQC [59], который предоставляет сводную информацию о количестве полных, фрагментированных и отсутствующих универсальных ортологов с единичными копиями для сравнительного анализа (BUSCO) в сборке. База данных Embryophyta (embryophyta_odb9; состоящая из 1440 консервативных однокопийных генов растений) и сборка генома в формате файла fasta были предоставлены в качестве входных данных для инструмента для расчета показателей BUSCO.

    TE annotation

    В качестве базовой библиотеки TE использовалась отобранная вручную библиотека мобильных элементов (maizeTE11222019), полученная от Консорциума TE кукурузы (MTEC; https://github.com/oushujun/MTEC). Новые TE генома кукурузы Ab10, не включенные в библиотеку MTEC, были структурно идентифицированы с использованием конвейера EDTA (v1.6.5) [60] с параметрами «-species maize -curatedlib maizeTE11222019». Библиотека MTEC, дополненная Ab10-специфическими TE, использовалась для аннотирования фрагментов TE с помощью RepeatMasker.Кодирующие последовательности сборки кукурузы B73 v4 были загружены из MaizeGDB и использованы для удаления последовательностей генов из библиотеки TE, созданной с помощью ЭДТА. Полногеномные аннотации TE были созданы с использованием библиотеки MTEC, дополненной EDTA (-anno 1). Показатели индекса сборки генома LTR (LAI) [61] были рассчитаны с использованием LAI (beta3.2) в пакете LTR_retriever (v2.8) [62] с параметрами «-iden 94.8550 -totLTR 76.34».

    Центромеры и анализ повторений

    Общая точность сборок центромер была оценена путем сопоставления предыдущих сборок центромер B73 на основе ВАС [37] с геномом B73-Ab10 с использованием Bionano RefAligner (v3.4.0) с параметрами по умолчанию. Хотя сборки на основе BAC не пересекают массивы CentC, наблюдается отличное общее согласие в последовательности и смежности (дополнительный файл 1: рис. S3).

    Положения активных центромер определяли путем идентификации областей, обогащенных CENh4 ChIP-seq, в конечной сборке с использованием считывания генома в качестве контроля. Считывания SE150 Illumina ChIP-seq были получены из SRA (SRX2737618) [63], а считывания генома 73X PE150 Illumina были подвергнуты субдискретизации до 30X с помощью seqtk (https: // github.com / lh4 / seqtk). Чтения ChIP-seq и чтения генома были обрезаны с помощью Trim Glore (v0.4.5; https://github.com/FelixKrueger/TrimGalore/) с параметрами по умолчанию и согласованы с окончательной сборкой с помощью BWA-MEM (v0.7.17 ) [64]. Epic2 [65] использовался для вызова пиков с выравниванием CENh4 ChIP-seq, установленным как обработка, выравнивание считывания генома как контроль, MAPQ (качество картирования) как 20, эффективный размер генома как 0,8, размер ячейки как 5000 и размер промежутка как 0 Эффективный размер генома конечного генома был рассчитан как доля уникальных 150-меров по сравнению с общими 150-мерами с использованием Jellyfish (v2.26) [66] (-m 150 -s 2193M-out-counter-len 1 -counter-len 1). Координаты активных центромеры были идентифицированы как острова со счетом выше 250 и кратным изменением выше, чем 4.

    координаты повторных массивов были идентифицированы с помощью взрывных knob180 и консенсусных последовательности CentC [63], в TR-1 (консенсус TTCTTTATATTCCAACTTTTTAGCAACTGTATGGTGGAAAAAGGTGTCTTACAACCTTAACCTATGTTTGGACAGTTCTCTCGTGCAATTTGGCTAAATTTCCCATGGTCTTTATTTTATTTTGAGAAACGATGTGGTATAATGATGTGCGATGTTTTACTTGAGTGGACATAAACACCATTTAGGTATGCCTTGAATAGAGGGGATTATTGGAAACCTGGTATCACAAAAGGTCATTAGCTAGCCCAATAACGTCTTCATCCACTAGTTATACTCTAATACCCTCTAGTGTGAATACAATGCCCACAATATCATAGAAACGTCATTTGAGGTTTAAAAGGTGATCTATTGTTTTGAA ), субтеломерный повтор (NCBI CL569186.1) и межгенные спейсерные последовательности рибосомальной ДНК (NCBI AF013103.1) против генома B73-Ab10. Узлы были определены как повторяющиеся кластеры (≥ 500 КБ), которые состоят не менее чем из 10% повторяющихся консенсусных последовательностей (knob180 и TR-1) с интервалом не более 100 КБ между повторяющимися единицами. Это определение knob180 knobs исключает субтеломерные массивы knob180. Массивы CentC определяются как повторяющиеся кластеры (≥ 100 Кб), которые состоят не менее чем из 10% согласованных последовательностей CentC.

    Неперекрывающиеся повторяющиеся единицы были количественно определены в каждом повторяющемся массиве с помощью настраиваемого сценария repeat_analyses.ру. Пять основных семейств длинных концевых повторов (LTR) -ретротранспозонов в выступах, массивах CentC и активных центромерах были индивидуально количественно определены с помощью bedtools (v2.28.0) [39]. Семейство Opie-Ji включает Opie , Ji , Ruda и Giepum , а семейство Prem1 состоит из Prem1 , Xilon , Diguus и Tekay . [67]. Центромерные ретротранспозоны CRM1 и CRM2 были количественно определены вместе и аннотированы как CRM в активных центромерных областях.

    Чтобы оценить обогащение отображаемых повторяющихся элементов в функциональных центромерах, каждый из элементов сначала был классифицирован на однозначно отображаемые или не однозначно отображаемые группы. К файлу выравнивания было применено пороговое значение MAPQ20, а для оценки покрытия генома на уровне пары оснований (-bga) использовались программные средства (v2.28.0). Неуникально отображенные местоположения (≤ 2 или ≥ 101 выровненных считываний) были объединены в острова с максимальным интервалом 1 КБ. Затем индивидуально оценивали обогащение CENh4 ChIP-seq для уникальных и неуникальных фракций CentC, CRM и пяти основных семейств ретротранспозонов LTR.Обогащение ChIP было рассчитано путем нормализации ChIP-seq относительно входных файлов bam выравнивания генома-seq с использованием метода нормализации RPKM с deepTools (v3.2.1) [68]. Были использованы параметры по умолчанию, за исключением следующих параметров: —operation ratio —scaleFactorsMethod None —normalizeUsing RPKM.

    Ученые наконец завершили геном человека

    Спустя два десятилетия после того, как проект последовательности генома человека был обнародован с большой помпой, команда из 99 ученых наконец-то расшифровала все.Они заполнили огромные пробелы и исправили длинный список ошибок в предыдущих версиях, дав нам новый взгляд на нашу ДНК.

    За последние недели консорциум разместил в Интернете шесть статей, в которых описывается полный геном. Эти столь востребованные данные, которые сейчас анализируются научными журналами, дадут ученым более глубокое понимание того, как ДНК влияет на риски заболеваний, говорят ученые, и как клетки удерживают ее в аккуратно организованных хромосомах, а не в молекулярных клубках.

    Например, исследователи обнаружили более 100 новых генов, которые могут быть функциональными, и определили миллионы генетических вариаций между людьми.Некоторые из этих различий, вероятно, играют роль в заболеваниях.

    Для Николаса Альтемоза, постдокторанта Калифорнийского университета в Беркли, который работал в команде, вид полного генома человека напоминает фотографии Плутона крупным планом с космического зонда New Horizons.

    «Вы могли видеть каждый кратер, вы могли видеть каждый цвет из чего-то, о чем мы раньше имели лишь самое смутное представление», — сказал он. «Это просто сбылась абсолютная мечта.

    Эксперты, не участвовавшие в проекте, заявили, что он позволит ученым гораздо более детально изучить геном человека. Большие фрагменты генома, которые раньше были пустыми, теперь расшифрованы настолько четко, что ученые могут приступить к их серьезному изучению.

    «Плоды этих усилий по секвенированию потрясающие, — сказала Юкико Ямасита, биолог развития из Института биомедицинских исследований Уайтхеда при Массачусетском технологическом институте.

    Хотя ученым на протяжении десятилетий было известно, что гены распределены по 23 парам хромосом, эти странные, похожие на червя микроскопические структуры оставались в значительной степени загадкой.

    К концу 1970-х ученые получили возможность точно определять несколько отдельных человеческих генов и расшифровывать их последовательность. Но их инструменты были настолько примитивны, что поиск одного гена мог занять целую карьеру.

    К концу 20 века международная сеть генетиков решила попытаться секвенировать всю ДНК в наших хромосомах. Проект «Геном человека» был смелым начинанием, учитывая, насколько много нужно было секвенировать. Ученые знали, что двойные нити ДНК в наших клетках содержат примерно три миллиарда пар букв — текста, достаточного для заполнения сотен книг.

    Когда эта команда начинала свою работу, ученые могли использовать лучшие технологии, секвенированные фрагменты ДНК длиной всего несколько десятков букв или оснований. Исследователям оставалось сложить их вместе, как кусочки огромной головоломки. Чтобы собрать пазл, они искали фрагменты с одинаковыми концами, то есть происходили из перекрывающихся частей генома. Им потребовались годы, чтобы постепенно собрать секвенированные фрагменты в более крупные полосы.

    Белый дом объявил в 2000 году, что ученые завершили первый набросок генома человека, и подробности этого проекта были опубликованы в следующем году.Но длинные участки генома оставались неизвестными, а ученые пытались выяснить, где принадлежат миллионы других оснований.

    Оказалось, что геном очень сложно собрать из маленьких кусочков. Многие из наших генов существуют в виде множества копий, которые почти идентичны друг другу. Иногда разные копии выполняют разную работу. Другие копии, известные как псевдогены, отключаются мутациями. Короткий фрагмент ДНК одного гена может так же хорошо вписаться в другие.

    А гены составляют лишь небольшой процент генома. Остальное может быть еще более непонятным. Большая часть генома состоит из вирусоподобных участков ДНК, которые существуют в основном для того, чтобы создавать новые копии самих себя, которые вставляются обратно в геном.

    В начале 2000-х ученые немного лучше научились складывать головоломку генома из ее крошечных кусочков. Они сделали больше фрагментов, прочитали их более точно и разработали новые компьютерные программы, чтобы собрать их в более крупные фрагменты генома.

    Периодически исследователи раскрывали последний, лучший проект генома человека, известный как эталонный геном. Ученые использовали эталонный геном в качестве ориентира для своих собственных усилий по секвенированию. Например, клинические генетики каталогизируют мутации, вызывающие болезни, сравнивая гены пациентов с эталонным геномом.

    Новейший эталонный геном вышел в 2013 году. Он был намного лучше, чем первый черновик, но был далек от завершения. Восемь процентов было просто пустым.

    «По сути, пропала вся хромосома человека», — сказал Майкл Шац, вычислительный биолог из Университета Джонса Хопкинса.

    В 2019 году два ученых — Адам Филлиппи, вычислительный биолог из Национального института исследования генома человека, и Карен Мига, генетик из Калифорнийского университета в Санта-Крузе — основали Консорциум теломер-теломеры для завершения генома.

    Доктор Филлиппи признал, что отчасти его мотивация для такого смелого проекта заключалась в том, что его раздражали отсутствующие пробелы.«Они просто меня очень раздражали», — сказал он. «Вы берете красивый пейзажный пазл, вытаскиваете сотню кусочков и смотрите на него — это очень надоедает перфекционисту».

    Доктор Филлиппи и доктор Мига призвали ученых присоединиться к ним, чтобы решить загадку. В итоге 99 ученых работали непосредственно над секвенированием генома человека, и еще десятки пытались разобраться в данных. Исследователи работали удаленно во время пандемии, координируя свои усилия с помощью приложения для обмена сообщениями Slack.

    «Это была удивительно красивая колония муравьев», — сказал доктор Мига.

    Консорциум воспользовался преимуществами новых машин, которые могут считывать участки ДНК длиной в десятки тысяч оснований. Исследователи также изобрели методы, позволяющие определить место в геноме особенно загадочных повторяющихся последовательностей.

    В общей сложности ученые добавили или зафиксировали более 200 миллионов пар оснований в эталонном геноме. Теперь они могут с уверенностью сказать, что человеческий геном измеряет 3.Длина 05 миллиардов пар оснований.

    В этих новых последовательностях ДНК ученые обнаружили более 2000 новых генов. Похоже, что большинство из них отключены в результате мутаций, но 115 из них выглядят так, как будто они могут производить белки — функции, на выяснение функции которых ученым могут потребоваться годы. По оценкам консорциума, геном человека содержит 19 969 генов, кодирующих белок.

    Когда, наконец, собран полный геном, исследователи смогут лучше изучить вариации ДНК от одного человека к другому.Они обнаружили более двух миллионов новых точек в геноме, в которых люди отличаются. Использование нового генома также помогло им избежать выявления связанных с болезнью мутаций там, где их фактически нет.

    «Это большой шаг вперед в этой области», — сказал доктор Мидхат Фаруки, директор по молекулярной онкологии в больнице Children’s Mercy в Канзас-Сити, штат Миссури, не принимавший участия в проекте.

    Доктор Фаруки начал использовать геном для своих исследований редких детских болезней, сравнивая ДНК своих пациентов с недавно заполненными пробелами для поиска мутаций.

    Однако переход на новый геном может стать проблемой для многих клинических лабораторий. Им придется перенести всю свою информацию о связях между генами и болезнями на новую карту генома. «Это будет большая работа, но это займет пару лет», — сказала доктор Шэрон Плон, медицинский генетик из Медицинского колледжа Бейлора в Хьюстоне.

    Доктор Альтемоз планирует использовать полный геном для исследования особенно загадочной области в каждой хромосоме, известной как центромера.Вместо хранения генов центромеры закрепляют белки, которые перемещают хромосомы вокруг клетки при ее делении. Область центромеры содержит тысячи повторяющихся сегментов ДНК.

    На первый взгляд, доктор Альтемоз и его коллеги были поражены тем, насколько разные центромеры могут быть у разных людей. Это наблюдение предполагает, что центромеры быстро эволюционировали, поскольку мутации вставляют новые части повторяющейся ДНК в области или вырезают другие части.

    Хотя часть этой повторяющейся ДНК может играть роль в разделении хромосом, исследователи также обнаружили новые сегменты, некоторые из которых имеют длину в миллионы оснований, которые, по-видимому, не задействованы.«Мы не знаем, что они делают, — сказал доктор Альтемоз.

    Но теперь, когда пустые зоны генома заполнены, доктор Альтемоз и его коллеги могут изучить их поближе. «Я очень рад двигаться вперед, чтобы увидеть все, что мы можем открыть», — сказал он.

    Анализ всего генома изолятов Escherichia coli, продуцирующих β-лактамазу AmpC или AmpC, от собак-компаньонов в Японии

    Распространенность 3GCR Enterobacteriaceae у собак-компаньонов

    Распространенность соответствующих AMR Enterobacteriaceae с точки зрения общественного здравоохранения человека (устойчивые к карбапенемам, 3GCR и фторхинолон-устойчивые (FQR) Enterobacteriaceae) [18,19,62] исследовали на 188 внекишечных бактериях, выделенных от 138 домашних животных. с подозрением на бактериальное инфекционное заболевание в Ветеринарном медицинском центре Университета префектуры Осака.Три, семь и девять из 65 изолятов Enterobacteriaceae были подозреваемы как 3GCR, FQR и как 3GCR, так и FQR, соответственно, в результате тестов на чувствительность к противомикробным препаратам, проведенных аутсорсинговой службой. Устойчивые к карбапенемам Enterobacteriaceae не были обнаружены в этом исследовании. Эти результаты согласуются с отчетами [18,19], описывающими распространенность 3GCR и FQR Enterobacteriaceae у домашних собак и кошек в Японии. 12 изолятов Enterobacteriaceae, подозреваемых в принадлежности к 3GCR, были выделены из внекишечных участков собак-компаньонов: мочевого пузыря, кожного абсцесса, брюшной полости, носовой полости или влагалища.В то время эти изоляты не считались внекишечными патогенными Enterobacteriaceae, потому что комменсальные Enterobacteriaceae могут вызывать внекишечную инфекцию при поражении хозяина [63]. Эти 12 изолятов были получены от аутсорсинговой службы и подтверждены тестом MIC на соответствие 3GCR (таблица 2). Было подтверждено, что девять из 12 изолятов 3GCR Enterobacteriaceae устойчивы к фторхинолону (идентификаторы: 001Sk, 019S, 019Sk, 024S, 026S, 056S, 066S, 082S и 123S в таблице 2). Устойчивый к фторхинолонам E . coli очень широко распространена у людей, и FQR часто сопровождается 3GCR, что в основном вызвано продуцированием ESBL [64]. Например, E . coli ST131 эволюционировал из клады B (чувствительный к FQ) в кладу C (FQR) посредством точечных хромосомных мутаций в конце 1980-х, а затем приобрел плазмиды, кодирующие ESBL, что привело к глобальному доминированию этой клады [65,66]. Enterobacteriaceae как с FQR, так и с 3GCR также недавно были обнаружены у домашних животных [67,68]. Учитывая, что 75% протестированных изолятов Enterobacteriaceae (9 из 12) в этом исследовании были как FQR, так и 3GCR, этот тип Enterobacteriaceae мог стать доминирующим среди 3GCR Enterobacteriaceae у домашних животных в Осаке, Япония.12 изолятов были дополнительно проанализированы на продукцию β-лактамазы с помощью дисковой диффузии и анализов синергизма (таблица 3). Пять изолятов (001Sk, 019Sk, 056S, 082S и 123S) продуцировали ESBL, а шесть изолятов (019S, 024S, 026S, 066S, 112S и 128S) были энтеробактериями, продуцирующими AmpC. Изолят Proteus vulgaris (048Sp) был чувствителен к цефотаксиму и цефтазидиму в диско-диффузионном анализе и, таким образом, не был охарактеризован в отношении продукции β-лактамаз. Все изоляты дали отрицательный результат на продукцию металло-β-лактамазы.

    Затем

    фекалий собак исследовали на наличие энтеробактерий, продуцирующих ESBL / AmpC. Четырнадцать изолятов 3GCR Enterobacteriaceae были выделены от 12 собак (таблица 2). Девять из 14 изолятов (001Fk, 019Fk, 024F, 026F1, 026F2, 048F, 049F, 082F и 123F) продуцировали ESBL E . coli или К . пневмония . Три изолята (019F, 026F3 и 066F) продуцировали AmpC E . coli . Два изолята (066Fc и 128F) были энтеробактериями, продуцирующими ESBL и AmpC (таблица 3).Эти результаты показали, что у 81,8% (9 из 11) протестированных собак-компаньонов в кишечном тракте были бактерии, продуцирующие ESBL / AmpC.

    Определение характеристик ESBL / AmpC на основе WGS

    E . изолятов кишечной палочки от собак-компаньонов

    Мы сфокусировались на 19 E . изолятов кишечной палочки из внекишечных участков и фекалий 11 собак (S1, фиг.). Эти изоляты принадлежали семи ST: ST131 (n = 6), ST162 (n = 5), ST68 (n = 2), ST405 (n = 2), ST998 (n = 2), ST10 (n = 1) и ST38 (n = 1).Кроме того, изоляты содержали одну, две или три копии генов ESBL / AmpC, кодирующих TEM-1A (n = 4), TEM-1B (n = 4), TEM-1C (n = 1), CTX-M- 14 (n = 1), CTX-M-15 (n = 3), CTX-M-27 (n = 6) и CMY-2 (n = 10). Для адресации E . изолятов coli от собак-компаньонов могут инфицировать людей, 14 E . Изоляты coli были секвенированы по полному геному (таблицы 4, 5 и S1), и было оценено их геномное сходство со штаммами, выделенными от человека.

    Во-первых, мы исследовали генетическое родство между несколькими изолятами от собак-компаньонов, принадлежащих к одному и тому же ST.Два предыдущих исследования показали, что максимальное количество SNP составляло четыре [69] и 15 [70] для одной и той же вспышки E . coli пищевое заболевание. Чтобы определить, происходят ли несколько изолятов от собак-компаньонов с одним и тем же ST из одного источника (принадлежат ли к одному и тому же событию вспышки), попарные различия SNP были измерены с использованием участков ядра генома из полногеномных последовательностей (таблица S2). Шесть и восемь различий SNP были идентифицированы для изолятов ST68 (026S и 026F3) и изолятов ST998 (128S и 128F) соответственно.В обоих изолятах ST один изолят (026S или 128S) был выделен из внекишечного участка, а другой (026F3 или 128F) — из фекалий одной и той же собаки. Эти результаты убедительно свидетельствуют о том, что эти два изолята в ST68 и ST998, соответственно, произошли из одного источника. PFGE и полученная дендрограмма также показали, что каждый E . Изолят coli из внекишечного участка имел наиболее близкое генетическое родство с изолятом из фекалий той же собаки (сходство паттернов> 85%) (S1 рис.).Колонизация кишечника внекишечным патогеном человека E . coli (ExPEC) была продемонстрирована на собаках-компаньонах [71]. Более того, близкородственные или неотличимые штаммы ExPEC (методами типирования) были получены от людей и их домашних животных [72,73]. Взятые вместе, эти результаты позволяют предположить, что внекишечные ESBL / AmpC собак продуцируют E . coli может передаваться с фекалиями, что может привести к перекрестной передаче человеку. Четыре изолята ST131 несли 77–178 SNP и вряд ли принадлежали к одному событию вспышки (таблица S2).В изолятах ST162 были идентифицированы три различия SNP между изолятами 019S и 066S, которые были получены от разных собак-компаньонов (таблица S2). Эти результаты убедительно свидетельствуют о том, что эти два изолята произошли из одного источника (возможно, из одной и той же вспышки).

    Затем были предсказаны близкородственные изоляты с использованием стратегии SNP на основе генома инструмента анализа одного генома в базе данных BacWGST, чтобы отследить источник 14 изолятов, секвенированных по всему геному, от собак-компаньонов (таблица S3).Изоляты 026F2, 048F, 049F, 056S, 082S, 112S и 123S имели близкие изоляты в базе данных BacWGST. Различия в SNP варьировались от 454 до 947 между изолятами (049F, 112S и 123S) и их ближайшими изолятами. Присутствие множества (сотен и более) SNP указывает на то, что изоляты были отдаленно родственны, что означает, что они не происходят из одной популяции резервуара [74]. Следовательно, источники изолятов 049F, 112S и 123S не могли быть отслежены или идентифицированы. Каждый изолят ST131 (026F2, 048F, 056S и 082S) отличался от своего ближайшего изолята 80–247 SNP.Все ближайшие изоляты были выделены из участков инфицирования человека и, вероятно, были человеческими ExPEC. Эти результаты свидетельствуют о том, что изоляты ST131 от собак-компаньонов произошли от человеческих ExPEC, хотя мы не смогли идентифицировать недавнего предка изолятов ST131 из-за высоких различий SNP.

    Далее мы сосредоточились на генах, ассоциированных с AMR. Четыре изолята (026F2, 048F, 056S и 082S) содержали bla CTX-M-27 в плазмидах группы несовместимости IncF с pMLST типа F1: A2: B20.Все эти изоляты принадлежали к типам ST131 и O25: h5: Fimh40. Два изолята (123S и 128F) содержали bla CTX-M-15 в плазмидах. Изолят ST38, 049F, обладал двумя генами bla CTX-M-14 на своей хромосоме. Семь изолятов (019S, 024S, 026F3, 066S, 112S, 128S и 128F) содержали bla CMY-2 , шесть из которых несли ген в плазмидах. Мы не смогли определить, находится ли ген bla CMY-2 изолята 024S на его хромосоме или на плазмиде, потому что мы не смогли успешно определить всю хромосомную последовательность.В нашем анализе гены β-лактамаз у изолята 026S не обнаружены. Все изоляты, кроме 112S, имели точечные мутации в областях белка, определяющих устойчивость к хинолонам. Устойчивость к фторхинолону требует одновременного присутствия по крайней мере трех мутаций в целевых белках, кодируемых на хромосоме; наиболее распространены аминокислотные замены в положениях S83 и D87 GyrA и S80 в ParC [75]. Два изолята, 128S и 128F, показали только одну точечную мутацию (S83L в GyrA), а также лишены плазмидных генов, связанных с устойчивостью к хинолонам qnr и aac (6 ) — Ib cr , что приводит к повышенной чувствительности к хинолонам.Напротив, оставшиеся изоляты имели по крайней мере три мутации, как описано выше, что привело к устойчивости к хинолонам (таблицы 2 и 4).

    (i)

    bla CTX-M-27 в линии передачи ST131.

    Четыре изолята (026F2, 048F, 056S и 082S) относятся к типу ST131 и O25: h5: Fimh40. Все эти изоляты содержали bla CTX-M-27 в мультирепликонной плазмиде, изображающей репликоны IncFIA / FIB / FII с pMLST типа F1: A2: B20, и приобрели устойчивость к фторхинолонам посредством точечных мутаций в parC (S80I и E84V). , parE (I529L) и gyrA (S83L и D87N).Эти результаты показывают, что эти четыре изолята принадлежат к кладе C1-M27 внутри клады C1 / H 30R [65,66]. В 2006 году изоляты C1-M27 линии ST131 были обнаружены у людей в Японии, и численность этой клады увеличилась в 2010-х годах [76]. Недавно эта клада возникла и распространилась во Франции и Германии [77,78]. Эти отчеты показали, что клады ST131 / C1-M27 ответственны за существенное увеличение ExPEC, продуцирующего ESBL, у людей. Мы рассмотрели, могут ли изоляты C1-M27 передаваться между собаками и людьми, и поэтому оценили геномное сходство между изолятами собак и человека.Хромосомные последовательности четырех изолятов C1-M27 от собак-компаньонов сравнивали с таковыми из линии ST131 человеческого происхождения C1-M27, клады C1 / H 30R, несущей bla CTX-M-14 , и клады C2 / H 30Rx, содержащий bla CTX-M-15 [78,79], извлеченный из базы данных NCBI. Филогенетический анализ, основанный на полногеномных SNP, показал, что изоляты в этом исследовании (подчеркнуты на рис. 1A) были очень похожи на производные от человека клады C1-M27 (окрашены в красный цвет на рис. 1A).В частности, E . coli str81009 (человеческий ExPEC, выделенный из мочи человека в ОАЭ в 2009 г.) нес 23–36 различий по SNP по сравнению с изолятами 026F2, 048F и 056S от собак-компаньонов (таблица S4). Эти различия SNP (23–36) между E . coli str81009 и изоляты 026F2, 048F и 056S были ниже, чем у собак-компаньонов (48–61 SNP). Взятые вместе, результаты предполагают, что каждый из трех изолятов 026F2, 048F и 056S произошел от человеческого ExPEC, а затем эволюционировал независимо.Затем мы сосредоточились на плазмиде IncF / pMLST F1: A2: B20, несущей bla CTX-M-27 . Плазмида из 026F2 показала 99,2% нуклеотидную идентичность и 100% охват запроса плазмидой ph205 человеческого происхождения при поиске методом blastn (рис. 1B). ph205 произошел от человеческого E . coli h205, выделенный в Германии в 2010 г., хромосома которого имеет высокое сходство с хромосомами изолятов 026F2, 048F и 056S на рис. 1A и в таблице S4. Две из четырех плазмид (плазмида 2 026F2: 026F2p2 и 048Fp2) имели гены, обеспечивающие устойчивость к аминогликозидам (aadA5 , aph (3 ») — 1b и aph (6) -1d ), макролидам ( миль / ч (A) ), тетрациклин ( tetA ), сульфонамид ( sul1 и sul2 ) и триметоприм ( dfrA17 ), которые были идентичны таковым в ph205 (рис. 1C).Все плазмиды имели структуру, подобную IS26-ΔISEcp1- bla CTX-M-27 -ΔIS903D / IS903D-IS26 [80–82] (рис. 1D). Структуры имели 100% идентичность в 026F2p2, 048Fp2 и 056Sp3 и были обычными в кладе C1-M27 человека [76,83]. В отличие от этого, плазмида 082Sp2 содержала интактный элемент IS903D между bla CTX-M-27 и IS26, который оказался уникальным, поскольку нет отчета, описывающего IS26-ΔISEcp1- bla CTX-M-27. -IS903D-IS26, насколько нам известно.Анализы конъюгативного переноса показали, что эти четыре плазмиды F1: A2: B20, несущие bla CTX-M-27 , могут передаваться горизонтально (таблица 6). Эти результаты убедительно свидетельствуют о том, что клады C1-M27 линии ST131 передаются между собаками-компаньонами и людьми, а также что плазмида F1: A2: B20 с bla CTX-M-27 может передаваться между штаммами, колонизирующими два вида хозяев.

    Рис. 1. Характеристики БЛРС E . coli ST131 изолятов.

    (A) Хромосомное филогенетическое дерево максимального правдоподобия, основанное на SNP по всему ядру генома, изображает четыре продуцирующих ESBL E . coli изолятов линии ST131 C1-M27 от собак-компаньонов (подчеркнуты), а также изолятов из линии C1-M27 человеческого происхождения ST131 (красный), клады C1 / H 30R, несущих bla CTX-M- 14 (зеленый) и клады C2 / H 30Rx, содержащие bla CTX-M-15 (синий), которые были извлечены из базы данных NCBI. E . coli JJ1886 использовали в качестве эталонного штамма. Хромосомная последовательность изолята 128S ST998 в этом исследовании использовалась в качестве внешней группы. (B) Плазмиды, кодирующие bla CTX-M-27 , выделенные в этом исследовании, сравнивали с очень похожей плазмидой ph205 из E . coli штамм 105. Гомологичные области заштрихованы серым цветом. Оранжевые полосы увеличены на рис. 1C. (C) Увеличение частичных последовательностей плазмиды, кодирующей bla CTX-M-27 , изображенной на фиг. 1B.Генетические элементы обозначены следующим цветом: bla CTX-M-27 , красный; другие гены устойчивости к противомикробным препаратам, оранжевый; IS26 tnpA , синий; IS903D tnpA , зеленый; другие мобильные генетические элементы, черные. Гены обозначены следующими номерами: dfrA17 , 1; aadA5 , 2; sul1 , 3; миль / ч (А) , 4; sul2 , 5; аф (3 ′ ′) — Ib , 6; aph (6) -Id ,7; tetA , 8. (D) Подробная информация о bla CTX-M-27 транспозонных элементов 026F2p2, 048Fp2, 056Sp3 (верхняя панель) и 082Sp2 (нижняя панель).IRL и IRR представляют собой инвертированные повторы каждой инсерционной последовательности. Нуклеотидные последовательности каждого IR являются следующими: IS26-IRL, GGCACTGTTGCAAA; IS26-IRR, TTTGCAACAGTGCC; IS903D-IRL, GGTTTTGTTGAATAAATC; IS903D-IRR, GATTTATTCAACAAAGCC; ISEcp1-IRR, ACTGTTAATTTAGG. Номера доступа изолятов и плазмид ST131 человеческого происхождения следующие: JJ1886, PRJNA218163; TO148, PRJEB27474; EC958, PRJNA283246; B36, PRJEB29930; AZ162, SAMN06187728; AR_0055, PRJNA2; TO143, PRJEB27473; TO60, PRJEB27477; str81009, PRJNA383781; h205, PRJNA387731; BRG120, SAMD00044968; КУН3594, САМД00044940; KSEC29, SAMD00044934; BRG274, SAMD00044971; КН94, SAMD00044963; КС46, SAMD00044955; ECph205, CP021871.1.

    https://doi.org/10.1371/journal.pone.0246482.g001

    (ii) Плазмиды, несущие ген

    bla CTX-M-15 .

    Два изолята (123S и 128F) содержали плазмиду, кодирующую bla CTX-M-15 . Нам не удалось определить всю последовательность плазмиды в 128F, но анализ контигов c5 и c6 128F (128Fc5c6) показал, что он принадлежит к группе несовместимости IncI1 / pMLST16 и несет два гена ESBL, bla CTX-M-15 и бла ТЕМ-1Б .Эта плазмида показала высокое сходство (97,9% идентичности, 95,0% охват запроса) с ранее опубликованной плазмидой pEC_Bactec из лошади E . coli , выделенный в 2010 г. [84] (рис. 2А). По сравнению с эталонной плазмидой pR64 для группы IncI1 из Salmonella enterica , pEC_Bactec возник в результате транспозиции Tn2, несущего bla TEM и ISEcp1- bla CTX-M-15 [84]. 128Fc5c6 имеет консервативный элемент гена транспозон-ESBL (Рис. 2B) [85–87].Ген bla TEM-1B был локализован в Tn2-подобном транспозоне, который обладал интактными инвертированными повторами длиной 38 п.о. (IR, окрашенный в зеленый цвет на фиг. 2B). Транспозон, подобный Tn2, фланкирован прямыми повторами длиной 5 п.н. (DR1 на фиг. 2B). Ген tnpA транспозона Tn2 был разрушен между нуклеотидами 209 и 210 путем транспозиции элемента ISEcp1- bla CTX-M-15 . ISEcp1-опосредованная транспозиция создала дупликацию целевой последовательности длиной 5 п.о. (DR2 на фиг. 2B).Этот механизм включал левый IR (IRL) ISEcp1 и правый альтернативный IR (IRR ’), который напоминал IRR ISEcp1 (IR окрашен в синий цвет на фиг. 2B). Плазмида обладала более чем 95% гомологией с pEC545 из человеческого E . Изолят coli (из Вьетнама в 2017 г.) и pKHSB1 из человеческого происхождения Shigella sonnei , который был распространен среди людей во Вьетнаме и Корее [88,89] (рис. 2A). IncI1 / pMLST16, несущий bla CTX-M-15 , был обнаружен у различных видов бактерий, континентов и видов-хозяев; например, человеческое происхождение E .Изоляты coli в Ирландии [90], полученные из крупного рогатого скота E . изолятов coli в Великобритании [90], человеческого происхождения S . enterica [91] и человеческий S . sonnei изолятов во Вьетнаме и Корее, описанных выше [89]. Учитывая, что плазмида, содержащая 128Fc5c6, была способна к горизонтальному переносу (Таблица 6), мы настоятельно предполагаем, что этот тип плазмиды используется совместно людьми и собаками-компаньонами. Плазмиды распространились на нескольких континентах, где обитают как зоонозные патогены, так и комменсальные виды бактерий, циркулирующие как среди людей, так и среди животных.Собаки-компаньоны могут способствовать распространению плазмид этого типа среди людей.

    Рис. 2. Характеристики плазмид, кодирующих bla CTX-M-15 .

    (A) IncI1 / pMLST16 contig 128Fc5c6, кодирующий bla CTX-M-15 сравнивали с прототипом или высокогомологичной плазмидой pR64 из S . enterica , pEC_Bactec из E . coli , pEC545 из E . coli и pKHSB1 из S . sonnei . Гомологические области заштрихованы серым. Генетические элементы обозначены следующими цветами: bla CTX-M-15 , красный; бла ТЕМ-1 , оранжевый; ISEcp1 tnpA , синий; ТН2 ТНПА , зеленый; другие мобильные генетические элементы, черные. (B) Детали транспозонного элемента bla CTX-M-15 128Fc5c6 на фиг. 2A. Нумерация пар оснований соответствует сегментам гена Tn2 tnpA , разделенным транспозоном.DR1 и DR2 обозначают прямые повторы из 5 пар оснований для Tn2 (GAAAA) и ISEcp1 (TCATA) соответственно. IR зеленого и синего цвета указывают на инвертированные повторы для Tn2 и ISEcp1 соответственно. (C) Плазмиду 123Sp5, кодирующую bla CTX-M-15 , IncFII K / K2: A-: B- сравнивали с pKpQIL, pKF3-94 и pIMP1572 из K . pneumoniae изолятов, которые имели высокую гомологию с 123Sp5. Гены обозначены следующим цветом: bla CTX-M-15 , красный; бла ТЕМ-1 , оранжевый; bla IMP или bla KPC , коричневый; другие гены устойчивости к противомикробным препаратам, розовый цвет; ISEcp1 tnpA , синий; ТН3 ТНПА , зеленый; другие мобильные генетические элементы, черные.Гены обозначены следующими номерами: tetA , 1; aac (6 ‘) — Ib-cr , 2; ARR-3 , 3; dfrA27 , 4; aadA16 , 5; sul1 , 6; миль / ч (A) , 7. (D) Детали транспозонного элемента bla CTX-M-15 123Sp5 на рис. 2C. Нумерация пар оснований соответствует сегментам гена Tn3 tnpA , разделенным транспозоном. DR1 и DR2 обозначают прямые повторы из 5 пар оснований для Tn3 (GTTAA) и ISEcp1 (TCATA) соответственно.L, R и R ’для мобильных элементов — это левый, правый и альтернативный правый IR соответственно. Нуклеотидные последовательности каждого IR являются следующими: Tn2 и Tn3-IRL, GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG; Tn2 и Tn3-IRR, CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC; ISEcp1-IRL, CCTAGATTCTACGT; ISEcp1-IRR, ACGTGGAATTTAGG; ISEcp1-IRR ’, ACGTAGGTCCCAGG; Tn1721-IRL, GGGGAGCCCGCAGAATTCGGAAAAAATCGTACGCTAAG; IS26-IRL, GGCACTGTTGCAAA; IS26-IRR, TTTGCAACAGTGCC. Номера доступа плазмид, полученных из базы данных, следующие: pR64, AP005147; pEC_Bactec, GU371927; pEC545, CP018975; pKHSB1, HF572032; pKpQIL, GU595196; pKF3-94, FJ876826; pIMP1572, Mh564586.

    https://doi.org/10.1371/journal.pone.0246482.g002

    Другая плазмида, 123Sp5, принадлежала к группе несовместимости IncFII K с типом pMLST K2: A−: B−. Этот тип плазмиды репликона произошел от K . pneumoniae [92,93] и был обнаружен в нескольких E . Изолятов coli [94], что указывает на то, что IncFII K / K2: A-: B- может переноситься из K . pneumoniae к другим видам бактерий.Конъюгальные анализы в этом исследовании показали, что 123Sp5 способен к горизонтальному переносу (Таблица 6), предполагая, что 123Sp5 может передаваться между этими двумя видами бактерий. Действительно, 123Sp5 обладал высокой гомологией с плазмидами из K . pneumoniae : IncFII K ранняя плазмида pKF3-94 [95] и pIMP1572 [96] (нуклеотидная идентичность, 99,97%; охват запросов, 79% и 98%, соответственно), и все плазмиды содержали bla CTX -М-15 (рис. 2С). pKpQIL, плазмида группы IncFII K2 (K2: A-: B-), является одной из наиболее распространенных плазмид, содержащих bla KPC [94,97].123Sp5 обладал меньшей гомологией (96,81% идентичности и 51% охвата запросов) с pKpQIL, чем с pKF3-94 и pIMP1572, и не обладал геном устойчивости к карбапенему. 123Sp5 был близок к pKF3-94, но обладал генами, обеспечивающими множественную лекарственную устойчивость к аминогликозидам ( aadA16 ), триметоприму ( dfrA27 ), фторхинолонам ( aac (6cl-Ib-cr ), тетрациклину ) (A макролиды ( миль / ч (A) ) и сульфонамид ( sul1 ) в дополнение к генам EBSL.Ген bla TEM-1C был локализован в Tn3-подобном транспозоне. Ген Tn3 tnpA был разрушен между нуклеотидами 372 и 373 с помощью элемента ISEcp1- bla CTX-M-15 [84–87] (Рис. 2D). Эта структура очень похожа на структуру 128Fc5c6 (фиг. 2B). Кроме того, Tn1721 tnpA , составляющий мобильный элемент tetA , был разрушен транспозонным элементом Tn3, несущим bla TEM-1C и ISEcp1- bla CTX-M-15 (рис. 2D).Это указывает на то, что bla TEM-1C и bla CTX-M-15 были вставлены после того, как элемент tetA был перемещен; и, следовательно, pKF3-94, по-видимому, не был прямым предком 123Sp5. Другая близкородственная плазмида, pIMP1572, дополнительно обладала bla IMP , потенциально приводя к устойчивости к карбапенему. В этом исследовании не было ясно, является ли плазмида 123Sp5-подобная или E . coli , несущая 123Sp5-подобную плазмиду, передавалась от человека к собакам-компаньонам.Однако распространенность плазмиды этого типа следует отслеживать в долгосрочной перспективе, поскольку мобильные элементы могут быть легко вставлены или удалены в локусе, кодирующем гены множественной лекарственной устойчивости, и плазмида может передаваться горизонтально за пределы бактериального вида.

    (iii) Хромосомная вставка

    bla CTX-M-14 .

    У нескольких видов бактерий хромосомный bla CTX-M (например, bla CTX-M-2 , bla CTX-M-14 и bla CTX-M- 15 ) были идентифицированы, вероятно, из-за транспозиции bla CTX-M из плазмиды в хромосому [98–100].Изолят 049F (ST38) обладал двумя хромосомными копиями bla CTX-M-14 (фиг. 3A). Наиболее близкородственный E . Штамм coli , 545, обладал плазмидой pEC545, в которой транспозонный элемент, ISEcp1- bla CTX-M-14 lamB , имел 100% гомологию с таковой в штамме 049F (положения нуклеотидов 89517-93993 на рис. 3В). Эти результаты предполагают, что ген bla CTX-M-14 в штамме 049F произошел от плазмидного транспозонного элемента, хотя дупликацию сайта-мишени (DR на фиг. 3B) идентифицировать не удалось.Другой элемент транспозона, несущий bla CTX-M-14 в штамме 049F (положения нуклеотидов 31540–35673 на рис. 3B), был идентичен, но на 343 п.н. короче, чем более крупный элемент (положения нуклеотидов 89517–93993). Эти результаты предполагают, что более крупный элемент был частично перенесен (например, положения нуклеотидов 89517– на рис. 3B) в хромосому посредством повторяющейся транспозиции, которая наблюдалась в E . изолятов coli с хромосомными bla CTX-M-14 [101].Элемент транспозона большего размера был вставлен рядом с yicI . Хамамото и др. . [101] обнаружили пять генов, смежных со вставкой элемента транспозиции bla CTX-M-14 : tetC , ompN , yhjQ , sraG и dacD . Это исследование недавно идентифицировало ген yicI , соседний с транспозонным элементом ISEcp1- bla CTX-M-14 lamB . Хромосомный bla CTX-M-14 был обнаружен в различных ST человеческого происхождения E .Изолятов coli [98]. Насколько нам известно, это было первое сообщение о ST38, несущем хромосомную bla CTX-M-14 , хотя ранее сообщалось о ST38, обладающем плазмидой, кодирующей bla CTX-M-14 [64] ; и поэтому стабильность хромосомного bla CTX-M-14 и его способность к межвидовой передаче остаются неясными. Хромосомное расположение bla CTX-M-14 считается одним из факторов, способствующих высокой распространенности этих E . изолятов кишечной палочки у человека [98]. Необходимо постоянное наблюдение за собаками-компаньонами.

    Рис. 3. Характеристики хромосомного сегмента, кодирующего bla CTX-M-14 из E . Изолят coli .

    Частичная хромосомная последовательность штамма 049F сравнивалась с таковой из наиболее близкого E . coli , штамм 545 (инвентарный номер NZ_CP018976). Гомологические области заштрихованы серым. Генетические элементы обозначены следующим цветом: bla CTX-M-14 , красный; lamB , розовый; yicI , зеленый; ISEcp1 tnpA , синий; другие мобильные генетические элементы, черные.Области (a) и (b) увеличены на фиг. 3B. (B) Детали транспозонных элементов bla CTX-M-14 штамма 049F на фиг. 3A. Цифры указывают положения хромосомных нуклеотидов. DR и IR обозначают прямые и инвертированные повторы, соответственно. Положения нуклеотидов 89517– идентичны положениям 31540–35673. Нуклеотидные последовательности каждого IR являются следующими: ISEcp1-IRL, CCTAGATTCTACGT; ISEcp1-IRR, CGTGGAATTTAGGG. Регистрационный номер для pEC545 — CP018973.

    https: // doi.org / 10.1371 / journal.pone.0246482.g003

    (iv) Плазмида, содержащая

    bla CMY-2 .

    Наиболее часто встречающейся β-лактамазой AmpC является CMY-2. CMY-2, переносимый плазмидами, распространяется по всему миру, в частности, в E . coli и Salmonella spp. от людей и животных [14,102]. Домашний скот, в частности домашняя птица, считаются резервуарами этих бактерий и являются возможным источником bla CMY-2 у людей [10].Это исследование показало, что 42,9% штаммов (6 из 14) обладали плазмидой, несущей bla CMY-2 (таблица 4). Мы не определили, находится ли ген bla CMY-2 в изоляте 024S на хромосоме или плазмиде, потому что нам не удалось определить всю хромосомную последовательность. Эти результаты предполагают, что плазмидный CMY-2 распространяется среди собак-компаньонов в Осаке, Япония. Различные типы плазмид, включая IncA / C, IncI1, IncI2 и IncFII, связаны с присутствием bla CMY-2 [90].В частности, плазмиды IncA / C и IncI1 часто считаются наиболее распространенными носителями bla CMY-2 [90,103]. Из шести плазмид в этом исследовании две (026F3c3 и 112Sc2) ​​принадлежали к группе IncI1. Две другие плазмиды (019Sp3 и 066Sp3) принадлежали к группе IncFII. Остальные две плазмиды (128Sp3 и 128Fc7) принадлежали к группе IncC (ранее IncA / C2).

    Сначала мы сосредоточились на группе несовместимости IncI1 (плазмиды 026F3c3 и 112Sc2). IncI1 стал одним из наиболее распространенных семейств плазмид в современных Enterobacteriaceae, полученных как от человека, так и от животных, и был подтвержден как передатчик генов AmpC, в частности гена bla CMY-2 , в изолятах от домашних животных [104] .Плазмида 112Sc2 принадлежала к pMLST12, которая в группе несовместимости IncI1 внесла особый вклад в широкое распространение bla CMY-2 [104] и теперь представляет собой эпидемическую плазмиду в птице и птицеводческих продуктах [10,105]. В США плазмида IncI1 / pMLST12, содержащая bla CMY-2 , была обнаружена у нескольких собак-компаньонов [106]. bla CMY-2 ген 112Sc2 находился внутри транспозоноподобной структуры, состоящей из ISEcp1- bla CMY-2 blc sugE (рис. 4A), который хорошо сохраняется в IncI1. Плазмиды / pMLST12, содержащие bla CMY-2 в E . coli и S . enterica штаммов [107,108]. Элемент транспозона был вставлен в ген yagA прототипной плазмиды IncI1 pColIb-P9 [109] из S . sonnei , фланкированный 5-пн DR (рис. 4A). Плазмида 112Sc2 проявила 97,94% идентичности и 87% покрытия запроса с помощью pColIb-P9 (pMLST11) и была тесно связана с несколькими плазмидами pMLST12: p19C93.1 из птичьего E . coli в Японии в 2007 г. (99.91% идентичности и 94% охвата запросов), pJB10 [105] из птичьего E . coli в Бразилии в 2015 г. (99,99% идентичности и 88% охвата запросов) и pCVM29188 [110] из птичьего S . enterica в США в 2003 г. (идентичность 99,99% и охват запросов 97%) (рис. 4B). Плазмида 112Sc2 также имела высокое сходство (идентичность 99,81% и охват запросов 84%) с плазмидой pMLST23, pCVM22462 [106], из S . Изолят enterica от собаки.Другая плазмида IncI1, 026F3c3, была нетипируемой, вероятно, потому, что не была определена полная последовательность плазмиды. Транспозоноподобный элемент ISEcp1- bla CMY2 blc sugE был консервативен, как и в 112Sc2, но этот элемент был вставлен в ген finQ , фланкированный DR из 5 пар оснований (рис. 4C). ). Нарушение гена finQ транспозонным элементом bla CMY-2 впервые было сообщено в S . Штамм enterica серотипа Choleraesuis SCB67 в 2004 г. [111].Кроме того, Su et al . [107] выявили, что транспозонный элемент, несущий bla CMY-2 , был вставлен в ген finQ области переноса pColIb-P9 в большинстве протестированных изолятов Enterobacteriaceae, включая K . pneumoniae , E . coli , S . enterica , Citrobactor spp., S . sonnei и M . morganii .Плазмида 026F3c3 не имела высокой гомологии с плазмидой из S . Choleraesuis SCB67 (идентичность 99,69% и охват запросов 47%), что позволяет предположить, что 026F3c3 не имеет прямого отношения к плазмиде из S . Choleraesuis SCB67. Ген finQ оказался горячей точкой для встраивания транспозонного элемента bla CMY-2 . Сравнение полных плазмидных последовательностей показало, что 026F3c3 имеет 99,23% идентичности и 88% охвата запросов с pColIb-P9 (рис. 4D).Одной из наиболее близких к 026F3c3 плазмид была psg_wt5, полученная из птичьего S . enterica в Сингапуре в 2016 году (99,53% идентичности и 93% охвата запросов), в котором отсутствовал транспозонный элемент bla CMY-2 . Плазмида 026F3c3 также обладала высокой гомологией (98,67% идентичности и 96% охвата запросов) с pCMY-2 из патогенного человеческого происхождения E . coli на Тайване в 2013 году, которые могут трансформироваться в другие виды бактерий, такие как K . pneumoniae [112]. Мы не смогли проанализировать 024S, потому что было неясно, находится ли bla CMY-2 на хромосоме или плазмиде, хотя частичная последовательность была высокогомологичной последовательности в плазмиде 026F3p3. Как для 112Sc2, так и для 026F3c3, высокогомологичные плазмиды были идентифицированы у неродственных видов бактерий, выделенных в разных странах и эпохах, что позволяет предположить, что плазмиды распространились на нескольких континентах в течение многих лет, будучи хозяевами как зоонозных патогенов, так и комменсальных видов бактерий, циркулирующих у обоих людей. и животные, включая собак-компаньонов.

    Рис. 4. Характеристики плазмид, кодирующих bla CMY-2 .

    (A) (C) (E) (G) Подробная информация о bla CMY-2 транспозонных элементов плазмид 112Sc2 (A), 026F3c3 (C), 019Sp3 и 066Sp3 (E), а также 128Sp3 и 128Fc7 (G). DR обозначают прямые повторы длиной 4–5 пар оснований: TGGGT (A), GATAA (C), GTTC (E) и ATTTC (G). IR указывают на инвертированные повторы. oriIS и terIS на фиг. 4E представляют собой ориентированные и терминированные инсерционные последовательности, соответственно. (B) (D) (F) (H) Плазмиды, кодирующие bla CMY-2 , сравнивали с прототипом и высокогомологичными плазмидами из E . coli (EC), S . enterica (SE) и S . soneii (SS). Генетические элементы обозначены следующими цветами: bla CMY-2 , красный; другие гены устойчивости — оранжевый; blc и sugE , розовый; гены, нарушенные кассетой ISEcp1- bla CMY-2 , зеленый; tnpA гены ISEcp1 и IS1294, синий; другие мобильные генетические элементы, черные. Гены обозначены следующими номерами: tetA , 1; aph (6) -Id , 2; аф (3 ′ ′) — Ib , 3; sul1 , 4; миль / ч (A) , 5; флоР , 6.Нуклеотидные последовательности каждого IR являются следующими: ISEcp1-IRL, CCTAGATTCTACGT; ISEcp1-IRR, ACGTGGAATTTAGG; ISEcp1-IRR ’на фиг. 4A, GAAGCGTTTGCAGG; ISEcp1-IRR ’на фиг. 4C, AACCAGAAAGTCGA; IS26-IRL, GGCACTGTTGCAAA; IS26-IRR, TTTGCAACAGTGCC; IS1294-oriIS, ACGTATAGGAAATTGAAAAAC; IS1294-terIS, TTGCAGCCGCCAGGCTGCCGTG. Номера доступа плазмид, полученных из базы данных, следующие: pColIb-P9, AB021078; p19C93.1, LC501481; pJB10, KX452392; pCVM29188, NC011077; pCVM22462, CP009566; psg_wt5, CP037994; pCMY2, LC019731; p74, CP023389; pAR-0429-1, CP044142; p23C50-1, LC501563; p3, CP031549.

    https://doi.org/10.1371/journal.pone.0246482.g004

    Далее мы сосредоточились на плазмидах IncFII / pMLST F40: A−: B− 019Sp3 и 066Sp3 от разных собак-компаньонов. Элемент транспозона IS1294- bla CMY-2 blc sugE консервативен в двух плазмидах. Кроме того, этот элемент был вставлен между генами, кодирующими гипотетический белок и колицин, фланкированный 4-п.н. DR в обеих плазмидах [113] (рис. 4E). Две плазмиды имели 100% гомологию; кроме того, количество SNP в ядре генома составляло три между 019S и 066S (таблица S2).Эти результаты показывают, что стандарт ST162 E . Изоляты coli , несущие плазмиду IncFII / pMLST F40: A-: B- с bla CMY-2 , могут распространяться среди собак-компаньонов. Эти изоляты могут быть преобладающими (или вспышками) среди собак-компаньонов в Осаке, Япония. Поиск Blastn показал, что одна из наиболее близкородственных плазмид, p74, из E . coli штамм 1105 (97,96% идентичности и 86% охвата запросов) был получен от собаки, у которой отсутствовал транспозонный элемент bla CMY-2 (рис. 4F).Наиболее близкородственная плазмида человеческого происхождения E . coli штамм 2014C-3741 имел меньшую гомологию (95,10% идентичности и 81% охват запросов) с таковой из штамма, полученного от собак. Плазмиды других видов бактерий также показали низкую гомологию: 93,92% идентичности и 74% покрытия pEG356 из S . sonnei , 96,63% идентичности и 66% покрытия с помощью pKP12226 из K . pneumoniae , 98,57% идентичности и 80% покрытия с p12-4374_62 из S . enterica . Кроме того, насколько нам известно, ST162 E . coli не распространена среди людей [14,114–116]. Таким образом, нет свидетельств того, что ST162 несет плазмиду IncFII / pMLST F40: A-: B- с bla CMY-2 , передаваемую между людьми и собаками-компаньонами.

    Другие плазмиды, 128Sp3 и 128Fc7, были получены от той же собаки. Они имели 100% гомологию последовательностей и принадлежали к группе IncC (ранее IncA / C2). Генетические структуры, окружающие bla CMY-2 , состояли из элемента ISEcp1 выше по течению, а blc и IS26 ниже по течению [117,118] (рис. 4G).Рис. 4A, 4C и 4E и предыдущие исследования [14,107,108] убедительно свидетельствуют о том, что транспозонный элемент bla CMY-2 состоит из IS- bla CMY-2 blc sugE . Ген sugE , DR и IRR ‘для ISEcp1 в плазмидах 128Sp3 и 128Fc7, по-видимому, был нарушен вставкой элемента IS26- mph (A) , хотя дублированные последовательности-мишени для IS26 не были идентифицированы в этом учиться. Нарушение гена sugE элементом IS26- миль в час (A) указывает на то, что bla CMY-2 присутствовал до того, как было вставлено миль в час (A) .Две плазмиды также несли гены устойчивости к тетрациклину ( tetA ), аминогликозидам ( aph (6) -Id и aph (3 ′ ′) — Ib ), сульфонамиду ( sul2 ), макролидам ( mph). (A) ) и хлорамфеникол ( floR ) (рис. 4H). Плазмиды IncC часто считаются одними из наиболее распространенных носителей bla CMY-2 [103,119]. Поэтому мы исследовали всю плазмидную последовательность наших плазмид на гомологию с таковыми из базы данных NCBI.Плазмиды pAR0429-1 из человеческого E . coli в США, p23C50-1 из птичьего E . coli в Японии в 2011 году и p3 из свиного E . coli cq9 в Китае в 2012 году были высокогомологичными (нуклеотидная идентичность, 99,94%, 99,61% и 99,98% соответственно; охват запросов, 96%, 100% и 98% соответственно) с 128Sp3 и 128Fp7 (рис. 4H) . Все высокогомологичные плазмиды обладали интактным транспозонным элементом ISEcp1- bla CMY-2 blc sugE и имели консервативные гены устойчивости tetA , aph (6) -Id ( aph (6) -Id , aph (6) -Id , aph (6) -Id , aph (6) 3 ′ ′) — Ib , sul1 и floR .Наиболее изменчивой была позиция, примыкающая к элементу транспозона bla CMY-2 . Плазмиды pAR-0429-1, p23C50-1 и p3 имели кассету размером> 56 т.п.н., содержащую гены конъюгативного переноса, ферредоксина, ДНК-метилтрансферазы и устойчивости к лекарственным средствам. Роль этой кассеты остается неясной, и она может ограничивать перенос плазмиды между людьми и животными. Этот тип плазмиды обладает генами множественной лекарственной устойчивости; поэтому необходим постоянный надзор за межвидовой передачей.

    (v) Гены вирулентности.

    Животные-компаньоны считаются резервуарами человеческого ExPEC, потому что близкородственные или неотличимые человеческие штаммы ExPEC были извлечены из людей и их домашних животных [71,73,120]. Поэтому мы сосредоточились на генах, связанных с вирулентностью, в E . изолятов coli , для которых был проанализирован весь геном (Таблица 5). Изоляция E . Штамм coli от пациента с внекишечной инфекцией сам по себе не дает обозначения ExPEC, поскольку комменсал E .Штаммы coli могут участвовать во внекишечных инфекциях, когда присутствует отягчающий или неблагоприятный фактор, такой как инородное тело, скомпрометированный хозяин или инокулят бактерий с высокой плотностью или смешанных видов [63,121]. Таким образом, все изоляты были проверены на статус ExPEC человека с использованием установленного молекулярного определения, состоящего из присутствия более двух из пяти определяющих ExPEC маркеров человека, то есть papAH и / или papC , sfa и / или . foc , afa и / или dra , iutA и kpsMII [122].Мы не смогли определить, были ли изоляты ExPEC собаками, потому что гены, связанные с вирулентностью, имеют разную распространенность у людей и животных [123], и нет молекулярных определений ExPEC собак. Следующие восемь изолятов принадлежали к группе ExPEC человека: четыре изолята ST131 C1-M27, несущие IncF / pMLST F1: A2: B20 с bla CTX-M-27 (026F2, 048F, 056S и 082S), ST68 изолят, несущий IncI1 с bla CMY-2 (026F3), изолят ST405, несущий IncFII K / pMLST K2: A-: B- с bla CTX-M-15 (123S) и два ST998 изолятов, несущих IncC / pMLST 3 с bla CMY-2 и IncI1 / pMLST 16 с bla CTX-M-15 (128S и 128F).Изоляты ExPEC ST131 человека, в частности, показали широкое распространение среди людей и домашних животных [115], а изоляты ST131 C1-M27, несущие bla CTX-M-27 , в этом исследовании были близки к изолятам, полученным от человека (рис. 1 и таблица S4), что убедительно свидетельствует о том, что некий E . изолятов кишечной палочки , которые продуцируют БЛРС, передаются от человека к собакам-компаньонам и вызывают внекишечные инфекции у обоих видов хозяев. Остальные пять изолятов не были ExPEC человека: ST162, несущий bla CMY-2 (019S, 024S и 066S), ST38, несущий bla CTX-M-14 (049F), и ST10, несущий bla . CMY-2 (112S).Мы считаем, что ST162, несущий плазмиду IncFII / pMLST F40: A-: B- с bla CMY-2 , вероятно, не передавался между людьми и собаками-компаньонами, как описано выше в разделе «Плазмида, несущая bla CMY-2 ». , потому что, насколько нам известно, нет отчета о ST162 E . coli преобладает у человека [14,114–116]. Однако есть и другая возможность; ST162 / bla CMY-2 может передаваться между людьми и собаками-компаньонами и вызывает внекишечные инфекции у собак-компаньонов, но не у людей, поскольку ST162 не является ExPEC человека.Важно оценить не только патогенный, но и комменсальный E . coli , чтобы выяснить точную роль собак-компаньонов в межвидовой передаче.

    В заключение, полногеномный анализ показал, что собаки-компаньоны в Осаке, Япония, обладают bla генами, которые различаются по генотипу, местоположению и типу несущей плазмиды. Некий E . Изоляты coli , продуцирующие ESBL / AmpC (т.е. ST131 / bla CTX-M-27 ), оказались способными к межвидовой передаче и вызывать внекишечные инфекции у обоих видов хозяев.Напротив, другие изоляты (например, ST162 / bla CMY-2 ), вероятно, не передавались от человека к собакам-компаньонам. Эти результаты предполагают, что специфический E . Штаммы coli могут передаваться между людьми и собаками-компаньонами. Предыдущие сообщения о метициллин-устойчивых Staphylococcus aureus (MRSA) и ванкомицин-устойчивых Enterococcus spp. (VRE) отражают эту идею; специфический тип последовательности MRSA был общим между животными-компаньонами и людьми без явной адаптации к животным [124], а конкретная форма транспозона, описанная только в VRE человека, была обнаружена в VRE, выделенном от собаки [124].Высокая гомология между тестируемыми плазмидами, полученными от собак, и плазмидами, происходящими от других хозяев, в частности, людей, и их способность к горизонтальному переносу (таблица 6) убедительно свидетельствуют о том, что плазмиды, несущие ген bla (т. Е. IncFII / F1: A2: B20 / bla CTX-M-27 , IncI1 / 16/ bla CTX-M-15 , IncI1 / bla CMY-2 ) может распространяться среди людей, собак-компаньонов и других животных. Необходимы дальнейшие исследования для подтверждения межвидовой передачи бактерий или плазмид, кодирующих ESBL или β-лактамазу AmpC, между людьми и домашними животными.

    .

    Оставьте комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *