Отрк точка у: Ракетный комплекс Точка-У — (ТРК) Тактический ракетный комплекс

Содержание

Тактический ракетный комплекс 9К79-1 Точка-У

Систему управления.Система управления — автономная, инерциальная, с бортовым цифровым вычислительным комплексом. Ракета управляема на всей траектории, что обеспечивает высокую точность попадания. При подлёте к цели для более эффективного использования энергии взрыва БЧ ракета совершает манёвр (доворот по углу тангажа), что обеспечивает угол встречи заряда с целью близкий к 90°. С этой же целью ось заряда осколочно-фугасной БЧ 9Н123Ф развёрнута вниз относительно оси корпуса головной части на определенный угол. Для достижения максимальной площади поражения обеспечивается воздушный подрыв БЧ 9Н123Ф на высоте 20 метров.

Бортовая аппаратура системы управления 9Б63 ракеты 9М79:

  • командно-гироскопический прибор 9Б64
  • дискретно-аналоговое вычислительное устройство 9Б65
  • гидропривод 9Б616:
    • блок автоматики 9Б66
    • питающая гидравлическая установка 6Б67
    • рулевая машина верхняя 9Б68 – 2 шт., рулевая машина нижняя 9Б69 – 2 шт.,
  • турбогенераторный источник питания 9Б149:
    • блок управления 9Б150
    • блок сопротивлений 9Б151
    • газотурбинный блок 9Б152
    • блок регуляторов 9Б242
  • датчик угловых скоростей и ускорений ДУСУ1-30В
  • комплект кабелей

Бортовая аппаратура системы управления 9Б84-1 ракеты 9М79-1:

  • командно-гироскопический прибор 9Б64-1
  • дискретно-аналоговое вычислительное устройство 9Б638
  • гидропривод 9Б640:
    • блок автоматики 9Б66-1
    • питающая гидравлическая установка 6Б639
    • рулевая машина 9Б89 – 4 шт.
  • турбогенераторный источник питания 9Б185:
    • блок управления 9Б150-1
    • блок сопротивлений 9Б189
    • газотурбинный блок 9Б186
    • блок регуляторов 9Б242-1
  • датчик угловых скоростей и ускорений ДУСУ1-30В
  • комплект кабелей

Ракета комплектуется следующими типами боевых частей:

  • АА-60 — ядерная мощностью от 10 до 100кт,
  • АА-86 — ядерная особой важности,
  • АА-92 — ядерная
  • 9Н123Ф — осколочно-фугасная сосредоточенного действия (см. описание),
  • 9Н123К — кассетная (см. описание),
  • 9Н123Ф-Р — осколочно-фугасная с пассивной радиолокационной ГСН.

Боевая часть ракеты в полете не отделяется. Стыковка ракетной и боевой частей осуществляется 6-ю откидными болтами с самоконтрящимися гайками по кольцевому соединению, электрическая связь БЧ с ракетной частью осуществляется кабелем через разъем Ш45. Наличие сменных БЧ расширяет диапазон применения комплекса и расширяет его эффективность. Ракеты в обычном снаряжении допускают хранение в окончательно собранном виде в течении 10 лет. Сборочные работы с ракетами в войсках проводить не требуется. При проведении регламентных работ не требуется извлекать приборы из корпуса ракеты.

В расчетах полётного задания при наведении «Точки» на цель используются цифровые карты местности, полученные по результатам космической или аэрофотосъемки территории противника.

Пусковая установка и транспортно-заряжающая машина

Основные боевые машины комплекса 9К79-1 «Точка-У»- пусковая установка 9П129М-1 и транспортно-заряжающая машина 9Т218-1

  • Аппаратура пусковой установки 9П129М-1 сама решает все задачи по привязке точки старта, расчету полетного задания и прицеливанию ракеты. Никакой топогеодезической и инженерной подготовки стартовых позиций и метеообеспечения при проведении пусков ракет не требуется. При необходимости через 16-20 минут после завершения марша и прибытия на позицию ракета может стартовать к цели, а еще через 1,5 минуты пусковая установка уже способна покинуть эту точку, чтобы исключить вероятность своего поражения ответным ударом. Во время прицеливания, несения боевого дежурства, а также при выполнении большинства операций пускового цикла ракета находится в горизонтальном положении и ее подъем начинается только за 15 секунд до старта. Этим обеспечивается высокая скрытность подготовки удара от средств слежения противника. В грузовом отделении пусковой установки смонтирована направляющая с механизмом изменения угла возвышения, на которой может транспортироваться одна ракета. В походном положении направляющая с ракетой установлена горизонтально, при этом грузовое отделение закрывается сверху двумя створками. В боевом положении створки раскрыты и направляющая установлена под углом возвышения 78°. Сектор стрельбы составляет ±15° от продольной оси ПУ.

  • Транспортно-заряжающая машина 9Т218-1 (ТЗМ) основное средство оперативного обеспечения стартовых батарей боезапасом для нанесения ракетных ударов. В ее герметизированном отсеке могут храниться и перевозиться по району боевых действий две полностью готовые к пуску ракеты с пристыкованными головными частями. Специальное оборудование машины, включающее гидропривод, стреловой кран и некоторые другие системы, позволяют в течение примерно 19 минут осуществить заряжание пусковой установки. Эта операция может быть выполнена на любой неподготовленной в инженерном отношении площадке, размеры которой позволяют поставить рядом бортами пусковую установку и транспортно-заряжающую машину. Ракеты в металлических контейнерах могут также храниться и перевозиться на транспортных машинах комплекса. Каждая из них способна разместить две ракеты или четыре головные части.

Пусковая установка и транспортно-заряжающая машина смонтированы на колесных шасси 5921 и 5922 Брянского автозавода. На обоих шасси установлен шестицилиндровый дизельный двигатель 5Д20Б-300. Все колеса шасси ведущие, шины с регулируемым посредством централизованной системы давлением воздуха 1200 х 500 х 508. Шасси имеют достаточно большой клиренс 400 мм. Для движения по воде предусмотрены водометные движители насосы пропеллерного типа. Подвеска всех колес независимая торсионная. Колеса первой и третьей пар — управляемые. На воде шасси управляется заслонками водометов и встроенных в корпус каналов. Обе машины способны передвигаться по дорогам всех категорий и вне их.

Кроме транспортной машины 9Т238 в состав комплекса так же входит транспортная машина 9Т222. Внешне они очень похожи и возможности по транспортировке у них идентичны. Обе являются активным автопоездом — т.е. мосты полуприцепа являются ведущими. Принципиальная разница между этими агрегатами в способе передачи крутящего момента от тягача к мостам полуприцепа — в одном случае передача гидравлическая, а в другом — механическая

Организационно комплекс входит в состав МСД или ТД, а также в отдельные бригады ( по 2-3 РДН), в дивизионе — 2-3 стартовые батареи, в батарее 2-3 пусковые установки. . Боевая работа проводится с ходу расчетом из 3-х человек в минимальные сроки. Благодаря наличию в ПУ системы топопривязки, прицеливания, средств связи, а также средств жизнеобеспечения при действиях на зараженной местности расчет ПУ может осуществлять пуски ракет из кабины.

Ракетный комплекс 9К79 (9К79-1) может транспортироваться самолетами АН-22, ИЛ-76 и т.д. Ракеты, ракетные части и БЧ могут транспортироваться вертолетами типа МИ-6, В-12, МИ-8.

Оперативно-тактические ракетные комплексы


Ракетный комплекс 9К79 «Точка»


Ракетный комплекс  9К79 «Точка» принят на вооружение Советской Армии в 1976 году.  Предназначен для поражения важных целей в глубине обороны противника – пунктов управления различных родов войск, узлов связи, стартовых и огневых позиций ракет, стоянок самолетов и вертолетов, резервных группировок войск, хранилищ боеприпасов и  топлива.


Это был  первый в Советском Союзе образец высокоточного оружия  наземного базирования. По своим тактико — техническим характеристикам  он значительно превосходил состоявшие в то время на вооружении тактические ракетные комплексы «Луна» и «Луна — М». Испытывали ракетный комплекс «Точка» воины Белорусского Военного округа на полигоне Капустин Яр. Одним из первых новый ракетный комплекс освоил  отдельный ракетный дивизион 120 — й гвардейской мотострелковой дивизии.


В 1984 году началась модернизация комплекса, основной целью которой было увеличение дальности и кучности стрельбы. Комплекс получил обозначение  «Точка — У». В 1989 году он был принят на вооружение.


Комплекс позволяет поразить цель, находящуюся на расстоянии от 15 до 120 км. При этом обеспечивается высокая точность на всей дальности полета ракеты, вне зависимости от метеоусловий, местности и прочих факторов. 


Стартовая масса ракеты  –  2000 кг, масса головной части – 480 кг. 


Пусковые установки и траспортно — заряжающие машины обладают высокой проходимостью и способны преодолевать водные преграды. По сравнению с зарубежными аналогами – американским комплексом «Ланс» и французским «Плутон» — советский комплекс обладал большей мобильностью, был проще в эксплуатации и дешевле в производстве.


 


 


 


8К 14 «Шквал» (Skud B)


 


 


Первая советская баллистическая ракета Р-1, разработанная на основе знаменитой немецкой ФАУ-2, унаследовала и её недостатки: капризность жидкостного двигателя и крайне низкую точность стрельбы. В 1953-м году ей на смену была создана новая ракета Р-11, получившая в НАТО название «Scud» (шквал). Дальность полёта составляла 150 км, а круговое вероятное отклонение (КВО) при поражении цели варьировалось в радиусе 3 км (у ФАУ – 10 км, а современные баллистические ракеты даже при межконтинентальных дальностях обладают КВО, не превышающем 100 м.)


На смену Р-11 в 1962-м пришла Р-17, которую в НАТО назвали «Scud» В. Она имеет в двое большую дальность полёта и намного лучшую точность – её КВО при попадании в цель на таком большом расстоянии составляет всего 450 метров. При взрыве почти тонны её взрывчатки образовывалась воронка глубиной пять и диаметром около ста метров. Площадь поражения составляла до 3 гектаров. Созданная в эпоху ядерного противостояния Р-17 могла вооружаться и ядерной боеголовкой. Для транспортировки и запуска ракеты было разработано гусеничное шасси на базе ИСУ-152, почти такое же, как и у Р-11. В нашей экспозиции представлена пусковая установка 8К 14, с ракетой Р-17 на четырёхосном колёсном шасси МАЗ-543П. В ходе модернизаций повышалась управляемость ракеты и точность поражения цели, что вызывало на Западе бурю негодований. Кто бы мог подумать, что «Шквал», созданный для сдерживания НАТО, будет использован на постсоветском пространстве в многочисленных гражданских войнах


 


 


 

Способна ли Украина создать ракеты средней дальности

«Украинские ракеты будут направлены на Москву в какое-то ближайшее обозримое время по одной простой причине, что мы работаем над ракетной программой. И наши ракеты оперативно-тактического уровня смогут доставать до Москвы», – сказал Алексей Арестович телеканалу «Дом».

Ракетная история Украины

Еще со времен СССР Украина располагает научной и научно-производственной базой для создания ракет. Особое место здесь занимает «Конструкторское бюро «Южное» им. М. К. Янгеля». За годы существования КБ созданы несколько типов космических ракет-носителей («Циклон-1М», «Циклон-4», «Циклон-4М», «Зенит-25LБ», «Зенит-35L», «Зенит-35LБ», «Зенит-35LБФ», «Днепр», «Маяк», «Антарес»), с использованием которых произведено около 500 запусков и выведено на орбиты более 1100 космических аппаратов.

В период с 1960-х по 1980-е годы в Днепропетровске (ныне в Днепре) были разработаны и внедрены в серийное производство межконтинентальные баллистические ракеты (МБР) тяжелого класса Р-36М, Р-36М УТТХ и МБР легкого класса УР-100, УР-100УТТХ, а также командная ракета 15А11 системы «Периметр». В конце 1980-х годов началось серийное производство ракетных комплексов уже четвертого поколения – Р-36М2 и РТ-23УТТХ (боевой железнодорожный ракетный комплекс «Молодец»), которые были приняты на вооружение в 1988-1990 годах. Многие из перечисленных изделий до сих пор остаются на вооружение РВСН России.

На момент распада Советского Союза на оснащении РВСН находилось 1398 МБР, на которых размещалось свыше 6,6 тысячи боезарядов.

На боевом дежурстве находились 444 ракеты разработки и производства «Конструкторского бюро «Южное» им. М. К. Янгеля», оснащенные 4176 боезарядами. Это составляло примерно 42% боевой мощи стратегических ядерных сил СССР.

К возможной кооперации исполнителей по производству ракет средней и большой дальности (головной исполнитель – КБ «Южное») следует добавить предприятие специального приборостроения «Арсенал» (все космические старты в СССР происходили с применением оптики именно этой фирмы), Харьковский приборостроительный завод имени Т. Г. Шевченко (автоматизированные системы управления боевыми ракетными комплексами).

Сюда же нужно приплюсовать Харьковский завод транспортного оборудования и «Харьковское конструкторское бюро по машиностроению имени А. А. Морозова» (разработка и производство пусковых установок).

Недостоверные разработки без денег

Сегодня КБ «Южное» разрабатывает оперативно-тактический ракетный комплекс (ОТРК) «Гром-2» на базе твердотопливной баллистической ракеты. В составе этого ОТРК предполагается иметь мобильную пусковую установку с двумя ракетами типа «земля-земля» на шасси пятиосного грузового автомобиля высокой проходимости. Дальность стрельбы «Гром-2», согласно заявлениям разработчиков, составляет около 1000 километров. Предполагается, что именно «Гром-2» будет основой сил неядерного сдерживания Украины.

Кроме ОТРК в «Южном» разрабатывается еще и семейство крылатых ракет под названием «Коршун», разработка которых также ведется в инициативном порядке и при поддержке иностранных партнеров. Ведется в «Конструкторском бюро «Южное» и разработка гиперзвуковых крылатых ракет под названием «Молния» («Блискавка»).

Проект представляет собой высокоскоростную ракету с гиперзвуковым прямоточным воздушно-реактивным двигателем со стартово-разгонной ступенью. Дальность действия новой крылатой гиперзвуковой ракеты может составлять порядка 480 км. Макет этого изделия впервые был представлен на выставке «Оружие и безопасность-2019» в Киеве.

Однако пока достоверной информации о том, что серийное производство оперативно-тактического ракетного комплекса «Гром-2» развернуто, система начала поступать на оснащение ракетных войск и артиллерии ВСУ, сформированы первые ракетные бригады, нет.

По данным из открытых источников, трудности связаны не столько с решением каких-либо инженерно-технических задач, а с отсутствием финансирования. Так, в в 2019 году и.о. гендиректора КБ Михаил Бондарь обратился с письмом в правительство Украины с просьбой предоставить срочный заем в $3,2 млн на погашение долгов по зарплате. Письмо попало в СМИ.

Среднесрочная угроза из Харькова

«В перспективе украинский ракетный удар по Москве вполне реален. Научно-технический и производственный потенциал для создания баллистических ракет средней и даже большой дальности, включая межконтинентальные, у Украины имеется. Вопрос только в финансировании», – пояснил «Газете.Ru» экс-заместитель начальника Главного оперативного управления Генерального штаба ВС РФ генерал-лейтенант Валерий Запаренко.

Как рассказал собеседник издания, в настоящее время на оснащении ВСУ имеются тактические ракетные комплексы типа «Точка-У» и реактивные системы залпового огня со сравнительно небольшой дальностью стрельбы. Однако в среднесрочной перспективе ВСУ могут получить ракетные комплексы с существенно большей дальностью стрельбы – от 1000 км и более.

Расстояние от Харькова до Москвы по прямой всего 647 км, напомнил генерал Валерий Запаренко. Время полета баллистической ракеты средней дальности в этом случае будет исчисляться минутами. Это практически сведет к нулю эффективность всех имеющихся возможностей отечественной Системы предупреждения о ракетном нападении, созданной на базе РЛС типа «Воронеж».

Время, когда на территории Харьковской, Черниговской и Сумской областей будут развернуты первые ракетные бригады украинских вооруженных сил, оснащенные перспективными оперативно-тактическими ракетными комплексами, не столь уж и велико, заключил генерал. И к этому надо быть готовыми уже сегодня, считает Валерий Запаренко.

«Комплексы Непобедимого – это был прорыв!» — «Красная звезда»



Просмотров:
1 278

100-летию со дня рождения генерального конструктора.

Сергей Павлович Непобедимый.

13 сентября 2021 года страна отметит 100-летие со дня рождения выдающегося конструктора управляемого ракетного вооружения Сергея Павловича Непобедимого. С.П. Непобедимый – Герой Социалистического Труда, лауреат Ленинской и трёх Государственных премий СССР, премии Совета Министров СССР, награждён тремя орденами Ленина и орденом Октябрьской Революции. Являлся членом-корреспондентом РАН, академиком РАРАН, доктором технических наук, профессором.

Под его руководством и при личном участии были сданы на вооружение 28 ракетных комплексов различного назначения. В их числе семейства ПЗРК «Стрела» и «Игла», семейство ТРК «Точка» и ОТРК «Ока», комплексы с применением первой в мире сверхзвуковой ракеты «Штурм» и другие.
О жизни и деятельности этого выдающегося конструктора написаны десятки статей, снят документальный фильм, написана книга.
Мы же сегодня предоставим слово военным. Пусть они скажут о вооружении, созданном Сергеем Павловичем Непобедимым.

Генерал-лейтенант Н.Н. Мухин, заместитель командующего РВиА ВС в период с 1992 по 2000 год:
– Так как я окончил Тульское артиллерийское училище в 1969 году, то успел послужить сразу на трёх ТРК: «Луна», «Луна-М» и «Точка». Каждый из них был шагом вперёд по сравнению с предыдущим. Но дальше всех шагнула «Точка».
После выпуска я приехал служить в Прикарпатский военный округ, где был назначен начальником расчёта в ракетный дивизион 161-й мсд. Моим заместителем был старшина Г.В. Святюк, который при первой встрече сказал:
– Товарищ лейтенант, вы всё знаете и умеете, я не сомневаюсь, но давайте договоримся: я буду делать за вас всю работу, а вы будете на учениях ездить старшим на КрАЗе.
Я удивился, но согласился. Потом понял, почему.
«Луна» имела гусеничный ход. В целях экономии ресурса на марше пусковую установку перемещали на прицепе к КрАЗу. Такая махина была крайне неустойчивой. Особенно зимой. В нашем дивизионе был случай. Мокрый снег, пусковая заезжает на прицеп. Небольшой перекос – и она падает на бок. Слава Богу, все живы остались. «Луна-М» и «Точка» передвигались уже своим ходом.
Расчёт «Луны» – семь человек. Трое – в холодной кабине, остальные едут следом на ГАЗ-66, грузовике «с утеплёнными дугами», как мы смеялись.

ПЗРК — это гениальное вооружение. Проще и качественнее зенитного оружия просто нет

Оперативно-тактический ракетный комплекс «Ока».

Расчёт «Луны-М» и «Точки» – уже четыре человека. Кабина отап­ливалась. Пусковая установка «Точки» в отличие от СПУ «Луны» имела пуленепробиваемый корпус.
У «Луны» и «Луны-М» наведение было одинаковым – по принципу арторудий: направляющие поворачивали вручную с помощью поворотного механизма. Угол поворота был небольшим. Чтобы ракета пошла в заданном направлении, нужно было точно заехать на позицию. Чуть ошибёшься – всё, ты задачу не выполнил. Надо проводить заезд по-новому, а времени уже нет… У «Точки» наведение другое. Заезжать достаточно было по основному направлению ±15 градусов.
Ракеты «Луна» и «Луна-М» были неуправляемыми в полёте, с жёсткими рулями для стабилизации и вращения, а ракеты «Точки» имели другие рули и корректировались на всей траектории полёта, это их главное отличие и преимущество. Если у ракет «Луна» и «Луна-М» круговое отклонение измерялось сотнями метров, то у «Точки» это были десятки метров и метры от центра цели.
Второе важнейшее преимущество – автономность и скрытность подготовки к пуску.
В середине семидесятых в Капустином Яре состоялся показ всех ракетных комплексов СВ первому заместителю министра обороны, будущему министру обороны С.Л. Соколову, тогда ещё генералу армии. Перед командным пунктом развернули по две пусковые всех комплексов, стоявших в то время на вооружении. Начался обратный отсчёт: готовность 3, готовность 2, готовность 1. У всех комплексов ракеты полчаса-час как подняты под разными углами, расчёты бегают, суетятся. Одна «Точка» стоит тихо, будто ничего не происходит. Только дым от двигателя.
Соколов:
– Там что-то случилось?
– Нет, товарищ генерал армии, всё идёт по плану.
И правда, через 125 секунд после нажатия кнопки «пуск» открылись створки, ракета поднялась и улетела. Это было очень впечатляюще.
Создание ракетного комплекса «Точка» является большим достижением коломенского КБМ в содружестве с волгоградскими «Баррикадами», московским ЦНИИАГ и другими предприятиями оборонно-промышленного комплекса СССР.

Переносный зенитный ракетный комплекс «Стрела-2М».

Генерал-майор Вячеслав Викторович Майоров, начальник штаба – первый заместитель начальника войсковой ПВО ВС РФ:
– Создание ПЗРК – это была революция в зенитном вооружении. Лёгкие, эффективные, они вызвали всеобщий восторг.
В войсковой ПВО ПЗРК состоит на вооружении как зенитных подразделений общевойсковых частей, так и в зенитных ракетных полках и бригадах как средство непосредственного прикрытия дальнобойных зенитных комплексов и систем.
Каждый ЗРК имеет мёртвую воронку, обусловленную определёнными тактико-техническими характеристиками вывода ракеты на кинематическую траекторию, то есть ближнюю границу зоны поражения. При появлении в этой зоне угрозы извне нужен ПЗРК — как средство ближнего действия. Все офицеры должны уметь его применять.
И я прошёл обучение работе с комплексом. Это гениальное вооружение. Проще и качественнее зенитного оружия просто нет.
Научиться применять его по простым целям можно за два-три дня. Доскональное изучение, конечно, требует большего времени.
Для освоения комплексов Конструкторским бюро машиностроения под руководством С.П. Непобедимого была создана линейка тренажёров для поэтапной подготовки стрелков-зенитчиков. Широко используется тренажёр «Конус». Он даёт полное погружение в процесс обнаружения цели, взятия на сопровождение и пуска. Все ошибки фиксирует инструктор на рабочем месте. Можно провести разбор действий. Это значительно экономит боевые средства и даёт отличный результат.
Для офицера войсковой ПВО переносный зенитный ракетный комплекс – как для любого другого офицера пистолет Макарова. Все, кто поступает в Военную академию войсковой ПВО ВС РФ имени Маршала Советского Союза А.М. Василевского, сдают нормативы с использованием тренажёра «Конус». Требуем поддержания навыков с подчинённых офицеров. Да и сами, генеральским составом, периодически «стреляем».
С момента появления ПЗРК применялись, наверное, во всех локальных войнах и вооружённых конфликтах, очень хорошо зарекомендовав себя как средства поражения воздушных целей различных типов в ближней зоне и непосредственного прикрытия подразделений и объектов.
Дебют состоялся во время арабо-израильской войны. В сентябре 1969 года египетскими стрелками-зенитчиками ПЗРК было сбито или повреждено 11 израильских самолётов. В июне-июле 1970-го ракетами ПЗРК сбит 21 израильский самолёт.
В 1972–1975 годах во Вьетнаме было произведено 589 пусков зенитных управляемых ракет 9М32 и 9М32М, в результате которых было зафиксировано 204 подтверждённых случая уничтожения американских и южновьетнамских летательных аппаратов.
В ходе боевого применения в Югославии в 1999 году большая часть американских «Томагавков» из тех, что югославам удалось сбить, были сбиты «Иглой-1».
Высокие мобильность и надёжность, простота в эксплуатации и относительно невысокая стоимость снискали высокий спрос на рынке вооружения. Например, «Иглу-1» поставили более чем в 30 стран мира.
В ходе боевого применения вырабатывались направления дальнейшего совершенствования комплекса, что С.П. Непобедимый и возглавляемый им коллектив постоянно делали.
И сейчас работы по созданию новых ПЗРК продолжаются. Конструкторское бюро машиностроения было и остаётся единственным разработчиком данного вооружения в стране и одним из двух разработчиков (наряду с США) в мире.
Алексей Владимирович Смирнов, полковник запаса:
– Из 25 лет армейской службы более двадцати служил в противотанковой артиллерии. Начинал с боевой машины 9П133 – это ПТРК «Малютка-П» с полуавтоматической системой управления. Старшим лейтенантом воевал на ней в Афганистане.
Комплекс, установленный на базе БРДМ-2, прежде всего обеспечивал манёвренность. Значительно сократилось время на занятие района сосредоточения и рубежей развёртывания. Для выживания человека размещение на автомобиле ещё более важно. Когда оператор, ничем не защищённый, на поле боя лежит с ранцем – это одно. В бронированной машине – другое.
Комплекс отличала высокая надёжность. Как ракет, так и машин. В нашем, 191-м отдельном мотострелковом полку батарея «Малюток-П» составляла противотанковый резерв. Машины стояли в качестве боевого охранения. В окопах. На открытой местности, где летом температура в тени до плюс 45–50 градусов, зимой мороз за тридцать, песчаные бури, – без всякого техобслуживания. При мне ни одной осечки не было: чтобы аппаратура не сработала, ракета не вылетела. Попадание стопроцентное. Согласно ТТХ машины угол возвышения должен быть не более 5 градусов. А мы в горах стреляли с превышением – до 15 градусов. Все работало.

Ракета «Оки» преодолевала ПРО в составе ЗРК «Найк-Геркулес» и «Хок», стоящих на вооружении НАТО, с вероятностью, близкой к единице

Осенью 1982 года заместитель командира полка будущий прославленный генерал Л.Я. Рохлин взял нас на операцию в Пандшер. Я был командиром взвода. Спросил, зачем нас берут? Рохлин ответил, что у душманов есть трофейные танки, они сумели затащить их в горы и установить в пещерах. Так и оказалось. Нашу колонну стали обстреливать. Рохлин давал целеуказания по радиостанции. Входы в пещеры были заложены камнями, оставалась только амбразура для танковой пушки. «Малютка» сначала камни разбивала, потом и сами танки. За эту операцию меня наградили орденом Красной Звезды.
Большой плюс комплекса – простота в эксплуатации. Через каждые полгода экипажи: механик-водитель и наводчик-оператор – менялись. В полку была традиция: человека не увольняют, пока на его место кто-то не придёт и пока он не обучит новичка работать с техникой не хуже, чем сам. Понятно, солдат хочет побыстрее домой уехать. За две недели обучали от и до.
Расположение полка было в 10 км от населённого пункта Газни, в поле. Вокруг горы. С этих гор нас начали через день обстреливать. Из автоматов, миномётов. Потери были. Тогда Рохлин собрал старейшин из окрестных кишлаков. А мне перед этим сказал: «Недалеко есть подбитые танки и БМП. Тебе надо показать всю мощь нашего оружия». Когда ракета попадает в танк – внешне ничего особенного не происходит. Поэтому в каждую машину мы предварительно засунули по бочке горючего. По рации получили команду. Пустили ракеты. Взрывы получились очень впечатляющими. Старейшины аж присели от неожиданности. После этого нас перестали обстреливать.
Вернулся из Афганистана – служил в Средней Азии. На смену «Малютке-П» пришёл «Штурм». Оружие другого поколения. На порядок лучше во всех отношениях. Гусеничная база обеспечила проходимость по любому бездорожью. Дальность боевого применения увеличилась с 3 до 5 км. Система управления более совершенная. Защищённость машины лучше. Бронепробитие у «Малютки» – 450 мм, у «Штурма» – 800 мм за динамической защитой. Максимальная скорость ракеты – 550 м/с, средняя – 350–370 м/с. Засечь трудно. Видел, как дозвуковой ПТРК стрелял на большую дальность. Пока ракета летела, танк успел спрятаться в укрытие. «Штурм» успевает уничтожить цель, он сверхзвуковой. Чем больше скорость, тем меньше полётное время и больше выстрелов можно произвести, скорострельность выше.
Заряжание производится автоматически. Машина имеет низкую посадку. В бою она менее заметна. В боевое положение приводится, когда командир обнаружил цель. Отстрелялась – автоматически переводится в походное положение. Это большой плюс. В боеукладке – 12 мощных ракет с разными боевыми частями. Если у предыдущих ПТРК БЧ были только для поражения бронированной и легкобронированной техники, то здесь появилась фугасная и осколочно-фугасная.
Ракеты «Штурм» унифицированы: применяются на сухопутных носителях, вертолётах, морских катерах.
Заслуга С.П. Непобедимого и в том, что он предусмотрел возможность дальнейшей модернизации и улучшения данного ПТРК. После штатного «Штурма» разработаны две модификации. При капремонте проводим модернизацию комплекса. «Штурмы» ещё долго будут оставаться основными противотанковыми средствами.

Борис Борисович Шишков, полковник в отставке:
– С 1977 года в звании старшего лейтенанта я испытывал «Оку» на 4-м Государственном центральном полигоне.
До «Оки» на вооружении стоял оперативно-тактический ракетный комплекс «Эльбрус» разработки выдающегося конструктора Виктора Петровича Макеева. Ракета 8К14 была жидкостной со всеми вытекающими отсюда особенностями: трудоёмкость при подготовке и проведении пуска, большое количество расчёта, несколько машин, которые готовили ракету к пуску. Твердотопливная «Ока» – это был прорыв. Она взяла всё лучшее от «Точки». Коллективу разработчиков удалось преодолеть ограничения по энергетической составляющей, которые имеет твёрдое топливо, и создать комплекс, лучше которого в мире не было. Абсолютно автономный. Не нужно машин-заправщиков и так далее. Сама определяла координаты, дирекционный угол. Расчёт получал целеуказание, ЭВМ считала полётное задание. Экипаж – всего три человека. Пусковая установка могла заехать в любую точку и произвести пуск, не привлекая больших сил и средств. Преодолевала небольшие реки без наведения понтонных переправ. В ракете 9М714Б впервые применили систему ориентации головной части. Это позволило, когда боевая часть отделялась от головной, стабилизировать колебания и ориентировать БЧ носиком на цель, за счёт чего достигалась очень большая вероятность преодоления ПРО (вкупе с защитным покрытием, которое не «светилось» при облучении). Всё это привело к тому, что ракета «Оки» преодолевала ПРО в составе ЗРК «Найк-Геркулес» и «Хок», стоящих на вооружении НАТО, с вероятностью, близкой к единице.
Для работы «Оки» не нужно было готовить позицию, рыть окопы, маскировать пусковую установку. Она работала с неподготовленной площадки. Была малозаметна. Ракета перенацеливалась на ±90 градусов, то есть не нужно было перезаездов на позицию.
Жидкостным ракетам 9К172 «Эльбрус» требовался подогрев пускового топлива. «Оке» не требовался.
Шасси БАЗ-6944 Брянского автозавода имело очень мягкую подвеску. И на хороших дорогах машины развивали скорость до 70 км в час. На грунтовке перепады дороги даже не ощущались. Машина шла плавно.
Помимо технических характеристик, конструкторы позаботились и о людях, об их физическом и психологическом здоровье. Шум от двух турбированных двигателей даже при наличии шлемофона был сильным. Когда ракета стартует, пусковую накрывает столб дыма и пыли. Экспериментальным путём выявили, что на расстоянии 60 метров от пусковой звуковой удар от запуска двигателей ослабевает до приемлемого для человека уровня. Поэтому у ПУ есть выносной пульт на 70 метров.
«Ока» была оснащена ракетами со специальной и кассетной боевыми частями. Поэтому в её задачу высокая точность не входила – лишь бы в заданный район попасть. Она сразу накрывала площадь примерно десять гектаров.
Американцы очень боялись этот комплекс. Он стоял на границах стран Варшавского договора: Югославии, Болгарии, ГДР. «Дотягивался» до любой точки Европы. На этом континенте немало американских баз. Самолётами «Оку» можно было перебросить и ближе к Штатам. Поэтому они и добились уничтожения комплекса.

Виктор Николаевич Климанов, председатель государственной комиссии по проведению испытаний ПТРК «Хризантема-С», полковник запаса:
– Мое знакомство с всепогодным противотанковым ракетным комплексом «Хризантема-С» произошло на этапе госиспытаний.
Основные заданные характеристики по точности поражения различных целей на различных дальностях стрельбы в самых сложных погодных условиях, в условиях пыледымовых помех, днём и ночью были подтверждены с высокими эффективностью и вероятностью поражения. Операторы, которые производили пуски практических и боевых ракет, отметили высокую надёжность обеих систем управления – в радиолокационном и в лазерно-лучевом каналах управления. Работа оператора в РЛСУ сводилась к тому, чтобы обнаружить цель, произвести её захват и взять на автоматическое сопровождение, после чего произвести пуск. Затем, не дожидаясь попадания в эту цель, перейти к поражению второй цели в ЛЛСУ.
По сравнению с другими ПТРК, которые также проводили различные виды стрельбовых испытаний на полигоне во время работы госкомиссии, выяснилось, что лазерный канал управления не уступает по надёжности и простоте применения разработке «Корнет». А наличие у БМ комплекса «Хризантема-С» РЛС коротковолнового диапазона выделяет комплекс не только среди лучших отечественных ПТРК, но и среди противотанковых комплексов стран мира, так как на этом комплексе впервые реализован принцип «выстрелил – забыл» в любых метеоусловиях.
Это, по сути, новый тип оружия.
Боевое применение комплекса обеспечивается сверхзвуковыми ракетами с тандемной кумулятивной и фугасной боевыми частями. Имелись случаи даже сквозного пробития бронеобъектов ракетой с тандемной кумулятивной боевой частью. Поражение цели типа дзот на минимальной дальности стрельбы – задача не совсем свойственная для ПТРК армейского подчинения, однако она была предусмотрена программой проведения госиспытаний. С помощью ЛЛСУ ракетой с фугасной БЧ такая задача была решена.
Размещение ПТРК «Хри­зан­те­ма-С» на современном гусеничном шасси подтвердило возможность его движения в танковых колоннах по пересечённой местности без всяких ограничений. Также подтвердилась возможность боевой машины преодолевать с ходу водные преграды. При движении машины на плаву был произведён пуск ракеты. Даже в таком положении боевые возможности комплекса «Хризантема-С» не снижаются. Ходовые качества боевой машины подтвердили возможность боевого применения ПТРК не только в оборонительных, но и в наступательных операциях, когда мобильность особенно важна.

Снарядили «Искандеры»: комплексы получат неуязвимый боеприпас | Статьи

«Искандеры» получили неуязвимые снаряды. Арсенал российских оперативно-тактических комплексов пополнился уникальными ракетами, выполненными по технологии стелс. Их практически нельзя обнаружить, при этом боеприпас может выполнять на траектории сложнейшие маневры, что позволяет ему уходить от противоракет противника и с особой точностью поражать наземные цели. Впервые новинку применили на учениях в прошлом году. По мнению экспертов, она радикально повысит боевые возможности российских Вооруженных сил.

По технологии стелс

Как рассказали «Известиям» источники в военном ведомстве, создание новинки началось еще в 2016 году. В настоящее время изделие находится в высокой степени готовности. Его испытание провели на полигоне Капустин Яр в августе прошлого года в рамках учений ракетных войск и артиллерии.

Новый боеприпас для «Искандера-М» имеет радиопоглощающее покрытие, обладает сверхманевренностью на траектории и способен поражать цели на расстоянии до 500 км. Сама ракета относится к классу аэробаллистических — летит по баллистической траектории, но при этом не покидает земную атмосферу.

На серии майских совещаний, посвященных военной тематике, Владимир Путин упомянул оперативно-тактический ракетный комплекс (ОТРК) «Искандер» в числе образцов высокоточного оружия, которые по ряду показателей являются уникальными и по характеристикам не только не уступают, но и превосходят иностранные аналоги.

В декабре 2019-го глава оборонного ведомства Сергей Шойгу заявил, что все ракетные бригады Сухопутных войск России перевооружены на ОТРК «Искандер-М». Они полностью заменили устаревшие комплексы «Точка-У» предыдущего поколения. Всего ими оснастили 13 соединений.

— Скорее всего, новый боеприпас является дальнейшим развитием аэробаллистической ракеты 9М723, которая уже несколько лет входит в состав комплекса «Искандер-М», — рассказал «Известиям» военный эксперт Дмитрий Корнев. — Чтобы уменьшить его радиолокационную заметность, необходимо было поработать с формой корпуса и носовой частью, применить новые типы материалов. Возможно, несколько изменилась и система управления, учитывая заявления о сверхманевренности ракеты.

Еще несколько лет назад генеральный конструктор Валерий Кашин заявил о том, что для «Искандера-М» создаются новые ракеты. Этот многоцелевой комплекс сам по себе уникален и может одновременно применять разные их типы: баллистические и крылатые, сообщил эксперт.

Боевое оснащение

На вооружении ОТРК «Искандер-М» уже состоит пять типов баллистических ракет и два — крылатых. Использование одновременно и тех и других позволяет поражать разные цели и делает удар неотразимым для существующих средств противоракетной обороны (ПРО).

— Квазибаллистические ракеты комплекса могут активно совершать маневры во время полета, их особенность в том, что на всем его протяжении они являются управляемыми, — отметил Дмитрий Корнев.

Современные отечественные и зарубежные системы ПРО научились уверенно перехватывать простые баллистические ракеты малой дальности. Поэтому боеприпасы для «Искандера» с самого начала спроектированы с возможностью непредсказуемо маневрировать на траектории с перегрузками до 20–30 g. Это резко затрудняет задачу уничтожения их комплексами ПРО.

— Ракеты «Искандеров» называются аэробаллистическими, потому что их корпус используется для увеличения дальности при полете в атмосфере, — рассказал «Известиям» военный эксперт Виктор Мураховский. — При пусках некоторых «Искандеров» на учениях можно было визуально наблюдать маневр по следу двигателей в атмосфере. Что касается малой заметности — корпус и рулевые поверхности изделия исполнены таким образом, чтобы иметь минимальную видимость в радиолокационном поле.

Ракеты достаточно универсальны. Их боевое оснащение различно: есть осколочно-фугасные, с проникающей боевой частью, с кассетным снаряжением, а если враг решится на применение оружия массового поражения, присутствует и ядерная боевая часть, пояснил эксперт. Для работы с такой техникой требуется квалифицированный персонал и хорошие средства разведки, чтобы получить точные координаты цели. Но у боеприпаса есть и возможности самонаведения по радиолокационному или оптическому изображению. В этом случае он самостоятельно корректирует траекторию на конечном участке и точно попадает в мишень, подчеркнул Виктор Мураховский.

Споры о дальности

С момента принятия «Искандера-М» на вооружение для него продолжали разрабатывать усовершенствованные боеприпасы. В 2019 году США заявили, что новая крылатая ракета комплекса с индексом 9М729 имеет дальность больше лимита в 500 км, установленного Договором о ликвидации ракет средней и меньшей дальности (ДРСМД). Это было использовано Вашингтоном как повод для выхода из этого соглашения.

В свою очередь, российское оборонное ведомство провело специальную открытую презентацию боеприпаса. По данным наших военных, изделие 9М729 имеет соответствующую ДРСМД дальность в 480 км. От предшествующей 9М728 оно отличается лишь боевой частью повышенной мощности, а также усовершенствованной точностью наведения.

Предшествующие модели ОТРК несли по одной баллистической ракете на пусковой установке. У обычных «Искандеров» на каждой размещено по две, что довело одновременный залп бригады до 24 штук.

Для использования нового боеприпаса была создана особая пусковая установка. Вместо двух крылатых ракет на ней помещаются четыре, что позволяет дополнительно нарастить огневую мощь залпа.

КБ машиностроения: от минометов до «Искандеров»

Фото: КБМ


Мировой лидер в создании ракетных систем – Конструкторское бюро машиностроения (КБМ) – отмечает в этом году свое 79-летие. За это время коллектив сдал на вооружение более 60 комплексов высокоточного оружия и их модификаций. Разработки КБМ у всех на слуху: ПЗРК семейств «Стрела», «Игла», новейшая «Верба», противотанковый ракетный комплекс «Хризантема-С», знаменитые «Искандеры-М». Рассказываем о самых ярких образцах ракетной техники из Коломны.

 



Противотанковые ракетные комплексы: от «Шмеля» до «Хризантемы»



Специальное конструкторское бюро гладкоствольной артиллерии, будущее КБМ, было организовано в 1942 году в Коломне для разработки минометной техники. Оружие, созданное под руководством выдающегося конструктора Бориса Ивановича Шавырина, составляло около 80% всех советских минометов Великой Отечественной войны.


В 1956 году СКБ переключается на ракетную технику как более прогрессивную в эпоху ядерного оружия и мощных быстроходных танков. Группу по созданию противотанкового ракетного комплекса возглавляет Сергей Павлович Непобедимый (будущий начальник и генеральный конструктор предприятия в период с 1965 по 1989 годы). Быстро освоившись с новой темой, коллектив бюро первым в стране разрабатывает ПТРК «Шмель», который в 1960 году встает на вооружение. «Шмель» использовался на боевых машинах и мог уничтожать цели на дальности до 2 км.



ПТРК «Малютка» на вертолете Ми-2


Следующим шагом стало создание в 1963 году более современного и малозатратного ПТРК «Малютка». Для него впервые сделали ракету с применением большого количества пластмасс, что позволило снизить размеры и вес оружия. Новый ПТРК мог пробивать броню толщиной свыше 400 мм и поражать цели на расстоянии до 3 км. Удачная конструкция, простота использования и, самое главное, низкая стоимость сделали «Малютку» и ее модификации самой популярной противотанковой ракетой XX века, которая до сих пор стоит на вооружении некоторых стран.



В 1960-е годы возникает потребность в более скоростных ракетных системах – сверхзвуковых. Предприятие, переименованное в 1964 году в Конструкторское бюро машиностроения, принимает и этот вызов. Здесь создается «Штурм» − первая в мире сверхзвуковая многоцелевая управляемая ракета с дальностью стрельбы до 5 км, появление которой существенно поменяло расклад сил на поле боя. Поставки оружия военным начались в 1976 году, а боевое крещение новый ПТРК получил в горах Афганистана. Сегодня «Штурм» применяется на боевых вертолетах и самоходных комплексах.

«Хризантема-С». Фото: НПО «Высокоточные комплексы»


Самой современной противотанковой техникой КБМ является комплекс «Хризантема-С». Главная особенность этого грозного «цветка» – обнаружение и поражение целей даже при плохих оптических условиях. Благодаря двум системам наведения – радиолокационной и лазерной − «Хризантема-С» способна работать ночью, при дожде, тумане или дымовых завесах и поражать сразу две цели. По словам создателей, это самый мощный и самый совершенный противотанковый комплекс в мире.




Переносные зенитные ракетные комплексы: «Стрела», «Игла» и «Верба»



В 1960-е годы в мире появляется принципиально новый вид ракетного вооружения – легкие и компактные переносные зенитные комплексы, выстрел из которых производится с плеча одним человеком. Основное их назначение − борьба с низколетящими воздушными целями. И снова пионером в нашей стране выступает КБ машиностроения, которое разрабатывает в 1968 году ПЗРК «Стрела-2». Оружие работало по принципу «выстрелил и забыл» и применялось во многих вооруженных конфликтах. Модификация «Стрела-2М», дальность поражения которой составляла до 4200 м, а высота поражения − до 2300 м, поставлялась более чем в 60 стран.


ПЗРК «Верба. Фото: КБМ


Тема получила развитие в виде ПЗРК «Игла», созданного в 1981 году. Главной целью разработки стало повышение эффективности и стойкости к противодействию. «Игла» способна работать в условиях тепловых помех и в любое время суток распознавать цели «свой-чужой». Современная модификация «Игла-С» усовершенствована для поражения малоразмерных целей – крылатых ракет и беспилотных устройств.


Новейший переносной комплекс «Верба», разработанный в 2014 году, – сегодня один из лучших в мире в своем классе. Дальность поражения комплекса – до 6000 м, высота – до 3500 м. По своей эффективности «Верба» превосходит предыдущее поколение ПЗРК в 1,5-2 раза, а защищенность от помех у нее выше в 10 раз. Комплекс может применяться в любых географических зонах, в том числе в горных и морских, в температурном диапазоне от -50 до +50 °С.

 



Тактические и оперативно-тактические ракетные комплексы: от «Точки» к «Искандеру-М»




Еще одним направлением, которым КБМ занимается с конца 1960-х годов, являются тактические и оперативно-тактические ракетные комплексы. Их задача – точечное поражение целей в тактической глубине войск противника. В 1975 году была завершена работа КБМ над первым подобным комплексом под названием «Точка». Это оружие было способно в считаные минуты поразить цель на дистанции от 15 до 70 км и так же молниеносно уйти с позиций. Впервые в СССР была разработана высокоточная ракета, и впервые для ее запуска требовалась только одна машина. В 1989 году для модификации «Точка-У» дальность была увеличена до 120 км.



Транспортно-заряжающая машина комплекса «Искандер-М» с ракетами. Фото: Боевая машина/wikimedia.org


Последней работой С.П. Непобедимого в бюро стал оперативно-тактический комплекс «Ока», в 1980 году принятый на вооружение. Его способности были фантастическими: стрельба на расстояние до 400 км, возможность оснащения ядерными зарядами, преодоление водных преград, работа в любых климатических условиях. При стрельбе ракеты «Оки» поднимались в ближний космос и были практически невидимы для противника. К сожалению, судьба комплекса была недолгой: по договору 1987 года между СССР и США о ликвидации ракет средней и меньшей дальности, который Непобедимый называл не иначе как предательством, все ОТРК «Ока» были уничтожены.





В 1988 году Непобедимый смог доказать руководству страны важность комплекса, подобного «Оке», но не подпадающего под условия договора. Так в КБМ началась история знаменитого теперь на весь мир «Искандера-М». На сегодняшний день этот оперативно-тактический ракетный комплекс является самым эффективным оружием мира в своем классе. ОТРК «Искандер-М», способный поражать цели с высокой точностью, составляет основу ракетных формирований Сухопутных войск. Разработка коломенского Конструкторского бюро машиностроения обладает большим модернизационным потенциалом и продолжает развиваться.

Долгий путь от «Точки-У» до «Гермеса»

Однако при этом в ракетных войсках обнажился сегмент тактического вооружения. И с экономической точки зрения замена «Точки-У» на комплекс, превышающий ее возможности по дальности почти в пять раз (120 против 500 км), нерациональна. Нанесение средствами ОТРК ударов на тактическую глубину означает чрезмерные затраты за счет использования более дорогостоящих ракет и эксплуатации комплексов чрезмерной мощности, которые имеют отнюдь не бесконечный ресурс.

При этом артиллерия неспособна в полной мере решать задачи ТРК. Лишь перспективная САУ «Коалиция-СВ» может стрелять на 80 километров активно-реактивными снарядами. Не годятся для этого и РСЗО, хотя системы залпового огня имеют необходимую дальность стрельбы, но не могут наносить точечные высокоточные удары. Однако существуют неплохие шансы, что в России скоро будет принят на вооружение современный ТРК.

От Макеева и Надирадзе

К созданию баллистических ракет в Советском Союзе приступили сразу после войны – в 1947 году. Жидкостная Р-1, разработанная в ОКБ-1 под руководством Сергея Королева с частичной проработкой трофейной документации немецкой «Фау-2», принята на вооружение в 1950-м. Тогда же она поступила и на боевое дежурство в специально созданную бригаду особого назначения резерва Верховного главнокомандующего в Астраханской области.

Дальность стрельбы Р-1 составляла 270 километров, стартовая масса – 13,4 тонны, длина – 14,6 и диаметр – 1,65 метра соответственно. Неядерная БЧ весила одну тонну, 785 килограммов приходилось на взрывчатое вещество. Инерциальная система управления обеспечивала квадратичное вероятное отклонение от цели (КВО) 1,5 километра.

Через год была принята Р-2 с улучшенными характеристиками. Ее дальность достигла 600 километров, масса неядерной БЧ – 1,5 тонны, КВО – 1,25 километра.

“ Есть неплохие шансы, что в России будет принят на вооружение современный тактический ракетный комплекс нового поколения ”

Первой баллистической ракетой, поступившей на вооружение Сухопутных войск в 1955 году, стала Р-11, летавшая на 270 километров, пусковая установка размещалась на шасси тяжелого танка ИС. Масса ракеты снизилась до 5,5 тонны, длина – до 10 метров. Масса неядерной БЧ – 670 килограммов. Однако по части точности БР уступала предшествующим ракетам – ее КВО ракеты увеличился на три тысячи метров. В значительной степени поэтому в 1958 году появилось ядерное оснащение ракеты Р-11М нескольких номиналов – 10, 20 и 40 килотонн.

Если все предыдущие образцы создавались в подмосковном Калининграде (ныне Королев) под руководством Сергея Королева, то Р-17 – в Миассе, в КБ машиностроения под руководством Виктора Макеева. Эта ракета на гусеничной ПУ пришла в войска в 1962 году. Летала на 300 километров и оснащалась как фугасной, так и ядерной БЧ мощностью 10 килотонн. Масса ракеты – 5,9 тонны, длина – 11,2 метра. Масса БЧ – 990 килограммов фугасного или ядерного типа мощностью 10 килотонн. КВО – 450 метров.

Р-17, точнее – ее экспортная модификация, получившая в НАТО название Scud B, стала на Ближнем Востоке столь же популярна, как и автомат Калашникова. Она поступала в больших количествах не только в армии Варшавского договора, но и богатого нефтяными запасами региона. Ближневосточные умельцы неоднократно модернизировали ее по своему разумению, добиваясь увеличения дальности, не придавая при этом большого значения ухудшающейся точности. И до сих пор «Скадами» «интернациональной разработки» обстреливается Израиль.

В 50-е годы шло множество других ракетных разработок, которые были прекращены по различным причинам: ОКР по «Коршуну» в ОКБ-3 НИИ-88 в подмосковном Калининграде, «Онега» в ОКБ свердловского артиллерийского завода № 9, твердотопливных ПР-1 и ПР-2 в НИИ-4 Минобороны, трех ракет «025», «034» и «036» «Вихрь» со сверхзвуковым прямоточным воздушно-реактивным двигателем в ОКБ 670 Министерства авиационной промышленности, «Нептун» с пороховым двигателем Московского института теплотехники (МИТ). Инженерная мысль фонтанировала.

И наконец, ученые МИТа совершили технологический прорыв, создав в 1959 году первую твердотопливную ракету – «Марс» 2К1. Она весила всего 1,75 тонны, размещаясь на шасси легкого плавающего танка ПТ-76. При этом дальность была невелика – 18 километров. Оснащалась ядерной БЧ и обычной весом в полтонны. КВО – 500 метров.

В том же 1958 году МИТ выдал еще одну твердотопливную ракету «Филин» 2К4. Ее масса увеличилась до пяти тонн, соответственно выросла и дальность полета, достигнув 26 километров.

Затем МИТ, руководимый Александром Надирадзе, выпустил еще несколько твердотопливных ракет. «Луна-М» с дальностью 65 километров стала вполне тактической ракетой, «Темп» и «Темп-С» уже «залезли» на территорию ОТРК (400 и 900 км соответственно). Произошло это уже во второй половине 60-х годов, тогда МИТ еще не начинал штурмовать создание межконтинентальных ракет.

Некоторые из перечисленных ракет в составе ТРК или ОТРК с различной степенью эффективности применялись в военных конфликтах. Наиболее известна Р-17 в составе ОТРК «Эльбрус», став участницей нескольких войн – Судного дня, афганской, в Персидском заливе, гражданской в Йемене… И уже в новом веке «Эльбрус» был использован в войне Саудовской Аравии с йеменскими хуситами, в недавних боевых действиях в Нагорном Карабахе. Комплекс «Луна-М» также был использован на Ближнем Востоке.

Как «Точка» посрамила «Патриот»

Тактический ракетный комплекс «Точка» создан в Коломенском КБ приборостроения под руководством легендарного конструктора Сергея Непобедимого – автора знаменитого ОТРК «Ока», предшественника «Искандера».

К разработке приступили в 1968 году, серийное производство развернули в 1973-м. На вооружение «Точку» приняли два года спустя.

В 1989 году подразделения начали поступать ракетный комплекс РК 9К79-1 «Точка-У» с увеличенной до 120 километров дальностью стрельбы. Конструкторы также усовершенствовали систему управления твердотопливной одноступенчатой ракетой комплекса, которая управляется при помощи решетчатых аэродинамических и газоструйных рулей. В начальном участке полета, когда скорость недостаточна для эффективной работы аэродинамических рулей, коррекцию полета осуществляют газоструйные. Ракета оснащена инерциальной системой управления, которая существенно отличается от механизма управления полетов использованного в образцах, предшествовавших «Точке». Гиростабилизированная система управления работает на всей траектории маршрута – от пуска до падения на цель или же, если быть точными, рядом с целью. Соответственно отслеживается направление полета ракеты и в случае необходимости корректируется. За счет этого было достигнуто существенное повышение точности стрельбы. Если у ракеты Р-17 КВО равно 450 метрам, то у «Точки-У» – всего 150–200 метров. Это объясняется тем, что в первом случае работа инерциальной системы управления прекращается после отключения маршевого двигателя, то есть ракета продолжает лететь уже как свободно брошенное тело.

Боевая машина БАЗ-5921 с ПУ расположена на колесном плавающем шасси. В состав ракетного комплекса входит также транспортно-заряжающая машина БАЗ-5922. Масса ракеты – 2010, БЧ – 480 килограммов соответственно. Длина – 6,4, диаметр – 0,65 метра. Максимальная скорость полета – 1100 метров в секунду. Время полета на максимальную дальность – 136 секунд. Экипаж БМ – четыре человека.

Для ракеты этого комплекса созданы различные боевые части:

  • три ЯБ с мощностью от 10 килотонн и выше;
  • осколочно-фугасная с 14,5 тысячи осколков. При подрыве на высоте 20 метров обеспечивает поражение живой силы на площади два-три гектара;
  • кассетная с 50 боевыми элементами массой 7,45 килограмма;
  • кассетная с 316 боевыми элементами массой 1,45 килограмма;
  • противорадиолокационная с пассивной радиолокационной ГСН;
  • две химические БЧ с различными ОВ.

С 1973 года и до окончания производства в первой половине 90-х выпущено около пятисот комплексов «Точка» и «Точка-У». После распада СССР большая часть (около трех сотен) осталась в России. Также комплексы осели в ряде бывших советских республик, и теперь постсоветские государства зачастую обращают их друг против друга, как это случилось в Карабахе минувшей осенью. А то и обстреливают своих граждан, как на Украине, где ВСУ использует ТРК «Точка» против жителей Донбасса. Эти комплексы использовали, используют и, несомненно, будут использовать в Сирии и Йемене.

Необходимо сказать, что ракета ТРК «Точка-У», казалось бы, при полном отсутствии механизмов преодоления зон ПРО способна совершать, можно сказать, чудеса. Саудовская Аравия буквально наводнена американскими ЗРК «Патриот». Но прилетающие из Йемена ракеты с легкостью проходят мимо «Патриотов», нанося саудитам громадный урон. Так, например, в декабре 2015 года одна-единственная 9K79 уничтожила 150 саудовских военнослужащих, а при обстреле в январе 2016-го число жертв достигло 200.

«Гермес» себя еще покажет

Вскоре после принятия на вооружение ТРК «Точка-У» в Тульском КБ приборостроения им. Шипунова открыли ОКР по созданию тактического ракетного комплекса «Гермес». И если бы в Туле все пошло нормально и ритмично, то даже за вычетом лихих девяностых сейчас в СВ не зияла бы дыра в секторе ТРК.

Но комплекс впервые смогли представить лишь в прошлом году на международном военно-техническом форуме «АРМИЯ». Он еще не готов, проходят испытания на полигоне Капустин Яр. Там же, где испытывались и «Точка», и «Эльбрус», и «Искандер».

Необходимо сказать, что туляки создают семейство комплексов. Помимо мобильного наземного «Гермеса», должны быть еще и «Гермес-А» авиационного, «Гермес-К» корабельного и «Гермес-С» берегового базирования соответственно.

«Гермес-А» с дальностью стрельбы 20 километров был готов еще в середине десятых годов. И этой ракетой сейчас оснащают ударные вертолеты Ка-52 «Аллигатор», Ка-52К «Катран» и Ми-28НМ «Ночной охотник». Однако до создания комплексов с индексами «К» и «С» еще далеко.

Максимальная дальность наземного «Гермеса» достигает 100 километров. Комплекс предназначен для поражения днем и ночью современных и перспективных танков, легкобронированных целей, инженерных и фортификационных сооружений, надводных целей, воздушных целей типа вертолетов и дронов с малыми скоростями.

Ракета наводится инерциальной системой управления, на конечном участке включается головка самонаведения, тип которой не раскрывается.

Для перспективного российского комплекса управляемого ракетного оружия разработаны две ракеты: с дальностью выстрела до 20 километров, авиационного базирования и с дальностью полета до 100 километров. Обе двухступенчатые бикалиберные. Того же типа ракеты используются и в ЗРПК «Панцирь-С1». Первая ступень разгоняется твердотопливным маршевым двигателем, вторая летит по инерции, в ней размещены система управления и БЧ массой 28 килограммов. За счет того, что диаметр второй ступени существенно меньше, чем первой, уменьшается сопротивление воздуха в полете и меньше падает скорость на финальном участке траектории. Максимальная скорость ракеты – 1300 метров в секунду, то есть около гиперзвука. Средняя – 500 метров в секунду.

Длина обеих ракет – 3,5 метра. Диаметр первой ступени дальней ракеты – 0,21, ближней – 0,17 метра соответственно. Диаметр второй ступени – 0,13 метра. Масса дальней ракеты – 130, ближней –110 килограммов соответственно. В БЧ массой 28 килограммов содержится 18 килограммов взрывчатого вещества. Бронепробиваемость – 1000 миллиметров.

На большей части траектории ракета летит под управлением инерциальной системы с коррекцией по сигналу GPS/ГЛОНАСС. На финише объект уничтожения захватывает головка самонаведения. При этом БЧ пикирует на цель почти под прямым углом – 75–80 градусов, что обеспечивает поражение в наименее защищенную верхнюю часть танка или иной бронетехники. То есть реализуется принцип атаки американского ПТРК «Джавелин», обладающего достаточно высокой эффективностью.

В составе комплекса «Гермес»: боевая машина на базе КамАЗа с десятью ракетами в транспортно-пусковых контейнерах, транспортно-заряжающая машина, машина управления, средства разведки – РЛС и беспилотный летательный аппарат.

Значение КВО не раскрывается. Однако комплекс позиционируется как высокоточный, что обеспечивается наличием у ракеты ГСН, а также возможностью коррекции полета по спутниковому навигационному сигналу. Существенное повышение точности позволило радикально уменьшить вес БЧ по сравнению с ракетой «Точка-У» – с 480 до 28 килограммов.

Между тем в госкорпорации «Ростех», куда входит Тульское КБ приборостроения, уже задумали провести модернизацию «Гермеса». Об этом в начале февраля сообщил индустриальный директор кластера вооружений, боеприпасов и спецхимии Ростеха Бекхан Оздоев. Он обещает увеличить боевое могущество «Гермеса 2.0» в 2–2,5 раза по сравнению с пока еще не прошедшим испытания и не принятым на вооружение «старым комплексом».

Консенсусная последовательность точки ветвления человека — yUnAy

GCCT

GCCT000

GCCC000 8

TGTCTTAATGTTGTTACCCTGACCCCAACAG

AATAGTGTGAATTCACTAGTGATCTACCTTTTTAG

GTTTGCTTCTCCAAG

EEF1A1

AGTAACGACTCTTAATCCTTACAG

ENO1

ATTGCTACTACATCTTTTTTCCTCTCATCCAG

0007

45

ENO1

0007

85

TTTTCCAAACCTGTTGTCACCATCTCTTCCCAG

ENO1

ENO1

AGGACAAACATTTTCTTCCATTTTTTTCCCCATAG

G22P1

AAGTCAAATCAAAGAAAATTTATCTCCTTTCTTCAG

0007

0007

0007

0007

0007

0007 922P1

0007

0007

0007

0007 922P160

GAPDH

TTGTCTCTTAG

000

000

000

000

000

AAACCAGATTTTTCTTTTTTTCAG

HSPCB

TGTACCACTTATTTTTGGTTTCTTTCAG

HSPCB

CAATCTAAGGCTTTTGTGATCGTCCACAG

LDHB

GGTTCTAATGCCTGTTTTTGCGTTTACAG

AAGTTGATCATGGTCTTGCATCTTTCTTTTTTAG

PGK1

PGK1

AATCTGAATGTCTTTGATCTTTTCTAG

PGK1

PKM2

75

ACGCTTGTCATCTTCCTTCTTTTCCCCCAG

PKM2

GGACTCTTGCTTACTCTCTTGTCCCTAG

000

000

000

000

000

000

000

000

000

000 TTGTCCCTAG

PKM2

на

CGTGCTCTGCCTCCCCTACTTACCCTTTTTCATACAG

-31C

GTGCTCTGCCTCCCCTACTTACCCTTTTTCATACAG

CTCTGCCTCCCCTACTTACCCTTTTTCATACAG

PKM2

на

CCTTTTGTGACAAAGCTCTGACAAAGCTCTGTCCC CCTCTCGTCCCTCTGGACGGATGTTGCTCCCCTAG

75

TTTACTCACCAACCTCCCTTCTCTTCCTCCAG

TTACTCACCAACCTCCCTTCTCTTCCTCCAG

RPL13

CCACTTAACTCTTCTCATTCACCAACAG

000

000

000

000

000

000

000

000

000

GTTTAACAACCTGTCTTTCTCTTCTAG

RPL13A

GAGTCCTTTTGCCCTTGTCTCCCACAG

TTGTCTCCCACAG

CTGACTACTGCTTTTTTTTTGCAG

RPL3

GGCGCTGAGGTGAAGTAATGTGTATCCATTCCAG

RPL3

AGCCTTACACCCTTCTTGTTCATTCAG

0004

ATATTAAAATGCATGGTGTGTCTTCTCTTACTACAG

SNRPB

SNRPB 90 006

SNRPB

TGGGCATCAGAGCATATTTGTTTATTTTTCAG

SNRPB

TCTTCTAACTCTTTCTTCTTATGTCCTCTTAG

GGCACTGACTAAACTTCTTACTCTTACTTCAG

UBB

ACTB 3 441 −24A 3.10 −30A 10 10 984 -24A 3,05 -26T 2 —
-25A 2 Т GTCTTAATGTTGTTACCCTGACCCCAACAG
−5A 1 ACCCCAACAG
CCT3 000 4 30 -32A 3 TGAATAGTGTGAATTCACTAGTGATCTACC TTTTTAG
-30T 1
−21A 2 T AATTCACTAGTGATCTACCTTTTTAG
CCT3 11 845 44 9.95 -24A 6 Т GCTTCATACTGTCTGTTTGCTTCTCCAAG
-10C 1
2 366 -24A 2.80 -28A 2 Т TAGTAACCAAGTAACGACTCTTAATCCTTACAG
-19C 1
EEF1A1 1 943 −33A 3.25 -23A 10 Т GGTTCAAAGTTTTTTTCTTCCATTTCAG
2 2837 -33A 3,25 -27T 6
−25C 2 T TGCTACTACATCTTTTTTCCTCTCATCCAG
-21A 10 Т CCCTCATTCTCCCCTCTCCCTCGTAG
5 737 -32A 3.20 -27A 6 Т ACTTCATTCCACTCGGTTCTCTTCTGTTCTAG
−24C 1 TCATTCCACTCGGTTCTCTTCTGTTCTAG
-30T 2 G CCCAGTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
-27C 3 AGTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
−26A 3 GTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
ENO1 7 796 −254A05 -38A 3 Т TACCTACCTGTTTTCCAAACCTGTTGTCACCATC TCTTCCCAG
-28C 1
-27A 2 Т TTTCCAAACCTGTTGTCACCATCTCTTCCCAG
-26A 2 Т TTCCAAACCTGTTGTCACCATCTCTTCCCAG
9 547 −30A 2.70 -5T 2 TGGCTTCCAG
11 1457 -26A 2,95 -48T 4 AGGTCTGACTTTTCTTTTTTCCTCCCCATCTCTTTACC TTTCTCCTTCCCAAG
-47G 2 GGTCTGACTTTTCTTTTTTCCTCCCCATCTCTTT ACCTTTCTCCTTCCCAAG
-46A 3 Т GTCTGACTTTTCTTTTTTCCTCCCCATCTCTTTACC TTTCTCCTTCCCAAG
G22P1 1 6031 −28A 2.90 -30A 2
-28A 4 Т GACAAACATTTTCTTCCATTTTTTTCCCCATAG
8 3212 -26A 2,50 -31A 2
-26A 1 Т AAATCAAAGAAAATTTATCTCCTTTCTTCAG
−25A 1 T AATCAAAGAAAATTTATCTCCTTTCTTCAG
-33A 10 GACTCACCAGGCCACTCTTCTGTGTTTTGATTT TCTAG
2 1633 -26A 3,35 -6T 10
HSPA8 1 734 −39A 3,15 −23A 1 T TTTTAAACCAGATTTTCTTTTTTTTTTT000

000

000 000 000
-17а 1 С ACCAGATTTTTCTTTTTTTCAG
6 448 18А 3.15 -22A 6 Т GTACCACTTATTTTTGGTTTCTTTCAG
-23C 1
10 777 -22A 3.20 -24T 1
-22A 2 Т ATCTAAGGCTTTTGTGATCGTCCACAG
HSPCB 1 1434 −22A 2.75 18А 1 Т AATTAATGAGATTTTTATTTTAG
2 7526 -22A 3,35 -24T 4
-23A 1 Т GTTCTAATGCCTGTTTTTGCGTTTACAG
-22A 6 Т TTCTAATGCCTGTTTTTGCGTTTACAG
PGK1 1 5461 −28A 3.00 -29G 2
-28A 4 Т AGTTGATCATGGTCTTGCATCTTTCTTTTTTAG
2 3826 −35A 3,00 −26T 4 CATTCTGTTTGTTGTCTCTCTTTTGGTTGCAG
PGK7 35 -33C 1 GGAGCCATCACATTTTCTGTTTTTGTTTTTCTCTA TAG
-29A 5 Т CCATCACATTTTCTGTTTTTGTTTTTCTCTATAG
5 635 -32A 3,40 -29A 1 Т TGACTAGAATCTGAATGTCTTTGATCTTTTCTAG
-22G 7
−21A 2 T ATCTGAATGTCTTTGATCTTTTCTAG 460007
000

000

000

000

15 -28A 1 Т TCTTTAAGTGATGATTCTTGCTTTCTCTTGTAG
-23A 8 Т AAGTGATGATTCTTGCTTTCTCTTGTAG
8 1499 −27A 3.20 −27A 10 T AGCTCATTCTCTTTCACCTCTACCCCTCAG
PGK1

000 000 000475 -36A 10 ATAGTAATGCTGTCTATGTATGTGTGCTCTCTC AAAAACAG
2 1443 -39A 3,05 -31A 2 Т AATTAATACTTGTGGCTTTAAAACTTTTCCTAATAG
-29A 1 Т TTAATACTTGTGGCTTTAAAACTTTTCCTAATAG
-25G 1 С TACTTGTGGCTTTAAAACTTTTCCTAATAG
−23G 1 C CTTGTGGCTTTAAAACTTTTCCTAATAG
000 000 000

000

000 -25T 3
-21A 4 Т TTGTCATCTTCCTTCTTTTCCCCCAG
4 487 -26A 2,85 -38T 1 TGGTGTCTCCAGTTTGGACTCTTGCTTACTCTCTTGT CCCTAG
-33A 1 Т TCTCCAGTTTGGACTCTTGCTTACTCTCTTGTCC ГКТД
-23C 1
-16A 1 Т TGCTTACTC TCTTGTCCCTAG
−8G 1 CTCTTGTCCCTAG
0007000
5 781 на -32T 1 —
1
-28C 3
-20A 90 007

1 Т CCCCTACTTACCCTTTTTCATACAG
-18T 1 CCTACTTACCCTTTTTCATACAG
-16A 2 T TACTTACCCTTTTTCATACAG
PKM2 6 1343 −29A 3.10 -39G 1 С CCTCTGTTCTATATAACCTCTCTCCCCCCAACTTTG TCCATCAG
-34A 6 Т GTTCTATATAACCTCTCTCCCCCCAACTTTG TCCATCAG
-32A 2 Т TCTATATAACCTCTCTCCCCCCAACTTTGTCCATCAG
8 4107 на -65T 2 —
−52T 1 AGCTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTC TGGACG40009000 9CTCCCTC TGGACG4CC000 9CTCCCTC TGGACG4CC0009 9CTCC000 9CT0007000 9CT0007000 9CT0007 07

−50A 5 T CTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTCTGGA CGGATGTTGCTCCCCTAG
PKM2 -27T 1
-26C 2
−25A 6 T TACTCACCAACCTCCCTTCTCTTCCTCCAG
PSMB4 4 393 9-404A 9000.05 -44A 4 Т CTGTTATTCAGCCCAATATCCCCCCATGGTTTTCC CCCAATCTCCCTAG
40А 5 Т TATTCAGCCCAATATCCCCCCATGGTTTTCCCCCA ATCTCCCTAG
4 583 -21A 3.30 -26A 1 С ACCCCACTTAACTCTTCTCATTCACCAACAG
-23T 1
−22A 4 T CACTTAACTCTTCTCATTCACCAACAG
000 000 000

000 00030 -22A 9
-20A 1 Т TTAACAACCTGTCTTTCTCTTCTAG
1 2205 -26A 3,55 -22C 7
-8T 1
RPL3 2 770 −21A 3.70 -21A 4 Т GTCTGACTACTGCTTTTTTTTTGCAG
-19T 3
4 1150 −22A 3.30 −24T 10 GGAGCTGAGCTGTGTCTACCTTCTCCTAG
RPL3

000

50 -29T 1
6 477 -34A 3.45 -22T 3
−21A 3 T GCCTTACACCCTTCTTGTTCATTCAG
RPL8 0007 0007 — GTTCCCTGAGGTATCTGATCCCCTACAG
SLC25A3 2 1591 −30A 2.85 -31A 1
1 2929 -24A 3.20 -24A 1 Т GTCTCATCCCTGTCCATTTCTCCTTGCAG
2 тысяча семьсот восемьдесят-семь -34A 3,85 -36T 2 — ACCTCTAACACTTTTTTTGTTCCTTCTAAAC CTCTCTTTAG
-35A 5 CCTCTAACACTTTTTTTGTTCCTTCTAAACC TCTCTTTAG
-34A 2 Т CTCTAACACTTTTTTTGTTCCTTCTAAAC CTCTCTTTAG
3 1808 -34A 9 0007

3.10 -30G 2 CACTGGGCATCAGAGCATATTTGTTTATTT TTCAG
-29G 3 ACTGGGCATCAGAGCATATTTGTTTATTTT TCAG
-28C 1 G CTGGGCATCAGAGCATATTTGTTTATTTTTCAG
-27A 2
4 519 −25A 3.75 -27T 7
-26A 1 Т CTTCTAACTCTTTCTTCTTATGTCCTCTTAG
−25A 5 T TTCTAACTCTTTCTTCTTATGTCCTCTTAG
SNRPB 6 696 95 -27T 8
1 717 -33A 3.45 -30T 6 TGAGGTGACACGCTTATGTTTTACTTTTAAA ГКТД
-29G 1 GAGGTGACACGCTTATGTTTTACTTTTAA ACTAG
-28A 2 Т AGGTGACACGCTTATGTTTTACTTTTAAACTAG

Консенсусная последовательность точки ветвления человека yUnAy

TCCCCAGTGTGACATGGTGTATCTCTGCCTTACAG

ALOD

TGTCTTAATGTTGTTACCCTGACCCCAACAG

ACCCCAACAG

AATAGTGTGAATTCACTAGTGATCTACCTTTTTAG

GTTTGCTTCTCCAAG

EEF1A1

AGTAACGACTCTTAATCCTTACAG

ENO1

ATTGCTACTACATCTTTTTTCCTCTCATCCAG

0007

45

ENO1

0007

85

TTTTCCAAACCTGTTGTCACCATCTCTTCCCAG

ENO1

ENO1

AGGACAAACATTTTCTTCCATTTTTTTCCCCATAG

G22P1

AAGTCAAATCAAAGAAAATTTATCTCCTTTCTTCAG

0007

0007

0007

0007

0007

0007 922P1

0007

0007

0007

0007 922P160

GAPDH

TTGTCTCTTAG

000

000

000

000

000

AAACCAGATTTTTCTTTTTTTCAG

HSPCB

TGTACCACTTATTTTTGGTTTCTTTCAG

HSPCB

CAATCTAAGGCTTTTGTGATCGTCCACAG

LDHB

GGTTCTAATGCCTGTTTTTGCGTTTACAG

AAGTTGATCATGGTCTTGCATCTTTCTTTTTTAG

PGK1

PGK1

AATCTGAATGTCTTTGATCTTTTCTAG

PGK1

PKM2

75

ACGCTTGTCATCTTCCTTCTTTTCCCCCAG

PKM2

GGACTCTTGCTTACTCTCTTGTCCCTAG

000

000

000

000

000

000

000

000

000

000 TTGTCCCTAG

PKM2

на

CGTGCTCTGCCTCCCCTACTTACCCTTTTTCATACAG

-31C

GTGCTCTGCCTCCCCTACTTACCCTTTTTCATACAG

CTCTGCCTCCCCTACTTACCCTTTTTCATACAG

PKM2

на

CCTTTTGTGACAAAGCTCTGACAAAGCTCTGTCCC CCTCTCGTCCCTCTGGACGGATGTTGCTCCCCTAG

75

TTTACTCACCAACCTCCCTTCTCTTCCTCCAG

TTACTCACCAACCTCCCTTCTCTTCCTCCAG

RPL13

CCACTTAACTCTTCTCATTCACCAACAG

000

000

000

000

000

000

000

000

000

GTTTAACAACCTGTCTTTCTCTTCTAG

RPL13A

GAGTCCTTTTGCCCTTGTCTCCCACAG

TTGTCTCCCACAG

CTGACTACTGCTTTTTTTTTGCAG

RPL3

GGCGCTGAGGTGAAGTAATGTGTATCCATTCCAG

RPL3

AGCCTTACACCCTTCTTGTTCATTCAG

0004

ATATTAAAATGCATGGTGTGTCTTCTCTTACTACAG

SNRPB

SNRPB 90 006

SNRPB

TGGGCATCAGAGCATATTTGTTTATTTTTCAG

SNRPB

TCTTCTAACTCTTTCTTCTTATGTCCTCTTAG

GGCACTGACTAAACTTCTTACTCTTACTTCAG

UBB

ACTB 3 441 −24A 3.10 -30A 10
8 984 -24A 3,05 -26T 2 —
-25A 2 Т GTCTTAATGTTGTTACCCTGACCCCAACAG
-5A 1
CCT3 4 1069 −21A 3.30 -32A 3 TGAATAGTGTGAATTCACTAGTGATCTACC TTTTTAG
-30T 1
−21A 2 T AATTCACTAGTGATCTACCTTTTTAG
CCT3 11 845 44 9.95 -24A 6 Т GCTTCATACTGTCTGTTTGCTTCTCCAAG
-10C 1
2 366 -24A 2.80 -28A 2 Т TAGTAACCAAGTAACGACTCTTAATCCTTACAG
-19C 1
EEF1A1 1 943 −33A 3.25 -23A 10 Т GGTTCAAAGTTTTTTTCTTCCATTTCAG
2 2837 -33A 3,25 -27T 6
−25C 2 T TGCTACTACATCTTTTTTCCTCTCATCCAG
-21A 10 Т CCCTCATTCTCCCCTCTCCCTCGTAG
5 737 -32A 3.20 -27A 6 Т ACTTCATTCCACTCGGTTCTCTTCTGTTCTAG
−24C 1 TCATTCCACTCGGTTCTCTTCTGTTCTAG
-30T 2 G CCCAGTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
-27C 3 AGTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
−26A 3 GTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
ENO1 7 796 −254A05 -38A 3 Т TACCTACCTGTTTTCCAAACCTGTTGTCACCATC TCTTCCCAG
-28C 1
-27A 2 Т TTTCCAAACCTGTTGTCACCATCTCTTCCCAG
-26A 2 Т TTCCAAACCTGTTGTCACCATCTCTTCCCAG
9 547 −30A 2.70 -5T 2 TGGCTTCCAG
11 1457 -26A 2,95 -48T 4 AGGTCTGACTTTTCTTTTTTCCTCCCCATCTCTTTACC TTTCTCCTTCCCAAG
-47G 2 GGTCTGACTTTTCTTTTTTCCTCCCCATCTCTTT ACCTTTCTCCTTCCCAAG
-46A 3 Т GTCTGACTTTTCTTTTTTCCTCCCCATCTCTTTACC TTTCTCCTTCCCAAG
G22P1 1 6031 −28A 2.90 -30A 2
-28A 4 Т GACAAACATTTTCTTCCATTTTTTTCCCCATAG
8 3212 -26A 2,50 -31A 2
-26A 1 Т AAATCAAAGAAAATTTATCTCCTTTCTTCAG
−25A 1 T AATCAAAGAAAATTTATCTCCTTTCTTCAG
-33A 10 GACTCACCAGGCCACTCTTCTGTGTTTTGATTT TCTAG
2 1633 -26A 3,35 -6T 10
HSPA8 1 734 −39A 3,15 −23A 1 T TTTTAAACCAGATTTTCTTTTTTTTTTT000

000

000 000 000
-17а 1 С ACCAGATTTTTCTTTTTTTCAG
6 448 18А 3.15 -22A 6 Т GTACCACTTATTTTTGGTTTCTTTCAG
-23C 1
10 777 -22A 3.20 -24T 1
-22A 2 Т ATCTAAGGCTTTTGTGATCGTCCACAG
HSPCB 1 1434 −22A 2.75 18А 1 Т AATTAATGAGATTTTTATTTTAG
2 7526 -22A 3,35 -24T 4
-23A 1 Т GTTCTAATGCCTGTTTTTGCGTTTACAG
-22A 6 Т TTCTAATGCCTGTTTTTGCGTTTACAG
PGK1 1 5461 −28A 3.00 -29G 2
-28A 4 Т AGTTGATCATGGTCTTGCATCTTTCTTTTTTAG
2 3826 −35A 3,00 −26T 4 CATTCTGTTTGTTGTCTCTCTTTTGGTTGCAG
PGK7 35 -33C 1 GGAGCCATCACATTTTCTGTTTTTGTTTTTCTCTA TAG
-29A 5 Т CCATCACATTTTCTGTTTTTGTTTTTCTCTATAG
5 635 -32A 3,40 -29A 1 Т TGACTAGAATCTGAATGTCTTTGATCTTTTCTAG
-22G 7
−21A 2 T ATCTGAATGTCTTTGATCTTTTCTAG 460007
000

000

000

000

15 -28A 1 Т TCTTTAAGTGATGATTCTTGCTTTCTCTTGTAG
-23A 8 Т AAGTGATGATTCTTGCTTTCTCTTGTAG
8 1499 −27A 3.20 −27A 10 T AGCTCATTCTCTTTCACCTCTACCCCTCAG
PGK1

000 000 000475 -36A 10 ATAGTAATGCTGTCTATGTATGTGTGCTCTCTC AAAAACAG
2 1443 -39A 3,05 -31A 2 Т AATTAATACTTGTGGCTTTAAAACTTTTCCTAATAG
-29A 1 Т TTAATACTTGTGGCTTTAAAACTTTTCCTAATAG
-25G 1 С TACTTGTGGCTTTAAAACTTTTCCTAATAG
−23G 1 C CTTGTGGCTTTAAAACTTTTCCTAATAG
000 000 000

000

000 -25T 3
-21A 4 Т TTGTCATCTTCCTTCTTTTCCCCCAG
4 487 -26A 2,85 -38T 1 TGGTGTCTCCAGTTTGGACTCTTGCTTACTCTCTTGT CCCTAG
-33A 1 Т TCTCCAGTTTGGACTCTTGCTTACTCTCTTGTCC ГКТД
-23C 1
-16A 1 Т TGCTTACTC TCTTGTCCCTAG
−8G 1 CTCTTGTCCCTAG
0007000
5 781 на -32T 1 —
1
-28C 3
-20A 90 007

1 Т CCCCTACTTACCCTTTTTCATACAG
-18T 1 CCTACTTACCCTTTTTCATACAG
-16A 2 T TACTTACCCTTTTTCATACAG
PKM2 6 1343 −29A 3.10 -39G 1 С CCTCTGTTCTATATAACCTCTCTCCCCCCAACTTTG TCCATCAG
-34A 6 Т GTTCTATATAACCTCTCTCCCCCCAACTTTG TCCATCAG
-32A 2 Т TCTATATAACCTCTCTCCCCCCAACTTTGTCCATCAG
8 4107 на -65T 2 —
−52T 1 AGCTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTC TGGACG40009000 9CTCCCTC TGGACG4CC000 9CTCCCTC TGGACG4CC0009 9CTCC000 9CT0007000 9CT0007000 9CT0007 07

−50A 5 T CTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTCTGGA CGGATGTTGCTCCCCTAG
PKM2 -27T 1
-26C 2
−25A 6 T TACTCACCAACCTCCCTTCTCTTCCTCCAG
PSMB4 4 393 9-404A 9000.05 -44A 4 Т CTGTTATTCAGCCCAATATCCCCCCATGGTTTTCC CCCAATCTCCCTAG
40А 5 Т TATTCAGCCCAATATCCCCCCATGGTTTTCCCCCA ATCTCCCTAG
4 583 -21A 3.30 -26A 1 С ACCCCACTTAACTCTTCTCATTCACCAACAG
-23T 1
−22A 4 T CACTTAACTCTTCTCATTCACCAACAG
000 000 000

000 00030 -22A 9
-20A 1 Т TTAACAACCTGTCTTTCTCTTCTAG
1 2205 -26A 3,55 -22C 7
-8T 1
RPL3 2 770 −21A 3.70 -21A 4 Т GTCTGACTACTGCTTTTTTTTTGCAG
-19T 3
4 1150 −22A 3.30 −24T 10 GGAGCTGAGCTGTGTCTACCTTCTCCTAG
RPL3

000

50 -29T 1
6 477 -34A 3.45 -22T 3
−21A 3 T GCCTTACACCCTTCTTGTTCATTCAG
RPL8 0007 0007 — GTTCCCTGAGGTATCTGATCCCCTACAG
SLC25A3 2 1591 −30A 2.85 -31A 1
1 2929 -24A 3.20 -24A 1 Т GTCTCATCCCTGTCCATTTCTCCTTGCAG
2 тысяча семьсот восемьдесят-семь -34A 3,85 -36T 2 — ACCTCTAACACTTTTTTTGTTCCTTCTAAAC CTCTCTTTAG
-35A 5 CCTCTAACACTTTTTTTGTTCCTTCTAAACC TCTCTTTAG
-34A 2 Т CTCTAACACTTTTTTTGTTCCTTCTAAAC CTCTCTTTAG
3 1808 -34A 9 0007

3.10 -30G 2 CACTGGGCATCAGAGCATATTTGTTTATTT TTCAG
-29G 3 ACTGGGCATCAGAGCATATTTGTTTATTTT TCAG
-28C 1 G CTGGGCATCAGAGCATATTTGTTTATTTTTCAG
-27A 2
4 519 −25A 3.75 -27T 7
-26A 1 Т CTTCTAACTCTTTCTTCTTATGTCCTCTTAG
−25A 5 T TTCTAACTCTTTCTTCTTATGTCCTCTTAG
SNRPB 6 696 95 -27T 8
1 717 -33A 3.45 -30T 6 TGAGGTGACACGCTTATGTTTTACTTTTAAA ГКТД
-29G 1 GAGGTGACACGCTTATGTTTTACTTTTAA ACTAG
-28A 2 Т AGGTGACACGCTTATGTTTTACTTTTAAACTAG

Консенсусная последовательность точки ветвления человека yUnAy

TCCCCAGTGTGACATGGTGTATCTCTGCCTTACAG

ALOD

TGTCTTAATGTTGTTACCCTGACCCCAACAG

ACCCCAACAG

AATAGTGTGAATTCACTAGTGATCTACCTTTTTAG

GTTTGCTTCTCCAAG

EEF1A1

AGTAACGACTCTTAATCCTTACAG

ENO1

ATTGCTACTACATCTTTTTTCCTCTCATCCAG

0007

45

ENO1

0007

85

TTTTCCAAACCTGTTGTCACCATCTCTTCCCAG

ENO1

ENO1

AGGACAAACATTTTCTTCCATTTTTTTCCCCATAG

G22P1

AAGTCAAATCAAAGAAAATTTATCTCCTTTCTTCAG

0007

0007

0007

0007

0007

0007 922P1

0007

0007

0007

0007 922P160

GAPDH

TTGTCTCTTAG

000

000

000

000

000

AAACCAGATTTTTCTTTTTTTCAG

HSPCB

TGTACCACTTATTTTTGGTTTCTTTCAG

HSPCB

CAATCTAAGGCTTTTGTGATCGTCCACAG

LDHB

GGTTCTAATGCCTGTTTTTGCGTTTACAG

AAGTTGATCATGGTCTTGCATCTTTCTTTTTTAG

PGK1

PGK1

AATCTGAATGTCTTTGATCTTTTCTAG

PGK1

PKM2

75

ACGCTTGTCATCTTCCTTCTTTTCCCCCAG

PKM2

GGACTCTTGCTTACTCTCTTGTCCCTAG

000

000

000

000

000

000

000

000

000

000 TTGTCCCTAG

PKM2

на

CGTGCTCTGCCTCCCCTACTTACCCTTTTTCATACAG

-31C

GTGCTCTGCCTCCCCTACTTACCCTTTTTCATACAG

CTCTGCCTCCCCTACTTACCCTTTTTCATACAG

PKM2

на

CCTTTTGTGACAAAGCTCTGACAAAGCTCTGTCCC CCTCTCGTCCCTCTGGACGGATGTTGCTCCCCTAG

75

TTTACTCACCAACCTCCCTTCTCTTCCTCCAG

TTACTCACCAACCTCCCTTCTCTTCCTCCAG

RPL13

CCACTTAACTCTTCTCATTCACCAACAG

000

000

000

000

000

000

000

000

000

GTTTAACAACCTGTCTTTCTCTTCTAG

RPL13A

GAGTCCTTTTGCCCTTGTCTCCCACAG

TTGTCTCCCACAG

CTGACTACTGCTTTTTTTTTGCAG

RPL3

GGCGCTGAGGTGAAGTAATGTGTATCCATTCCAG

RPL3

AGCCTTACACCCTTCTTGTTCATTCAG

0004

ATATTAAAATGCATGGTGTGTCTTCTCTTACTACAG

SNRPB

SNRPB 90 006

SNRPB

TGGGCATCAGAGCATATTTGTTTATTTTTCAG

SNRPB

TCTTCTAACTCTTTCTTCTTATGTCCTCTTAG

GGCACTGACTAAACTTCTTACTCTTACTTCAG

UBB

ACTB 3 441 −24A 3.10 -30A 10
8 984 -24A 3,05 -26T 2 —
-25A 2 Т GTCTTAATGTTGTTACCCTGACCCCAACAG
-5A 1
CCT3 4 1069 −21A 3.30 -32A 3 TGAATAGTGTGAATTCACTAGTGATCTACC TTTTTAG
-30T 1
−21A 2 T AATTCACTAGTGATCTACCTTTTTAG
CCT3 11 845 44 9.95 -24A 6 Т GCTTCATACTGTCTGTTTGCTTCTCCAAG
-10C 1
2 366 -24A 2.80 -28A 2 Т TAGTAACCAAGTAACGACTCTTAATCCTTACAG
-19C 1
EEF1A1 1 943 −33A 3.25 -23A 10 Т GGTTCAAAGTTTTTTTCTTCCATTTCAG
2 2837 -33A 3,25 -27T 6
−25C 2 T TGCTACTACATCTTTTTTCCTCTCATCCAG
-21A 10 Т CCCTCATTCTCCCCTCTCCCTCGTAG
5 737 -32A 3.20 -27A 6 Т ACTTCATTCCACTCGGTTCTCTTCTGTTCTAG
−24C 1 TCATTCCACTCGGTTCTCTTCTGTTCTAG
-30T 2 G CCCAGTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
-27C 3 AGTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
−26A 3 GTGCCATGCTTCTCTGCTCTGCTCTCCCCAG
ENO1 7 796 −254A05 -38A 3 Т TACCTACCTGTTTTCCAAACCTGTTGTCACCATC TCTTCCCAG
-28C 1
-27A 2 Т TTTCCAAACCTGTTGTCACCATCTCTTCCCAG
-26A 2 Т TTCCAAACCTGTTGTCACCATCTCTTCCCAG
9 547 −30A 2.70 -5T 2 TGGCTTCCAG
11 1457 -26A 2,95 -48T 4 AGGTCTGACTTTTCTTTTTTCCTCCCCATCTCTTTACC TTTCTCCTTCCCAAG
-47G 2 GGTCTGACTTTTCTTTTTTCCTCCCCATCTCTTT ACCTTTCTCCTTCCCAAG
-46A 3 Т GTCTGACTTTTCTTTTTTCCTCCCCATCTCTTTACC TTTCTCCTTCCCAAG
G22P1 1 6031 −28A 2.90 -30A 2
-28A 4 Т GACAAACATTTTCTTCCATTTTTTTCCCCATAG
8 3212 -26A 2,50 -31A 2
-26A 1 Т AAATCAAAGAAAATTTATCTCCTTTCTTCAG
−25A 1 T AATCAAAGAAAATTTATCTCCTTTCTTCAG
-33A 10 GACTCACCAGGCCACTCTTCTGTGTTTTGATTT TCTAG
2 1633 -26A 3,35 -6T 10
HSPA8 1 734 −39A 3,15 −23A 1 T TTTTAAACCAGATTTTCTTTTTTTTTTT000

000

000 000 000
-17а 1 С ACCAGATTTTTCTTTTTTTCAG
6 448 18А 3.15 -22A 6 Т GTACCACTTATTTTTGGTTTCTTTCAG
-23C 1
10 777 -22A 3.20 -24T 1
-22A 2 Т ATCTAAGGCTTTTGTGATCGTCCACAG
HSPCB 1 1434 −22A 2.75 18А 1 Т AATTAATGAGATTTTTATTTTAG
2 7526 -22A 3,35 -24T 4
-23A 1 Т GTTCTAATGCCTGTTTTTGCGTTTACAG
-22A 6 Т TTCTAATGCCTGTTTTTGCGTTTACAG
PGK1 1 5461 −28A 3.00 -29G 2
-28A 4 Т AGTTGATCATGGTCTTGCATCTTTCTTTTTTAG
2 3826 −35A 3,00 −26T 4 CATTCTGTTTGTTGTCTCTCTTTTGGTTGCAG
PGK7 35 -33C 1 GGAGCCATCACATTTTCTGTTTTTGTTTTTCTCTA TAG
-29A 5 Т CCATCACATTTTCTGTTTTTGTTTTTCTCTATAG
5 635 -32A 3,40 -29A 1 Т TGACTAGAATCTGAATGTCTTTGATCTTTTCTAG
-22G 7
−21A 2 T ATCTGAATGTCTTTGATCTTTTCTAG 460007
000

000

000

000

15 -28A 1 Т TCTTTAAGTGATGATTCTTGCTTTCTCTTGTAG
-23A 8 Т AAGTGATGATTCTTGCTTTCTCTTGTAG
8 1499 −27A 3.20 −27A 10 T AGCTCATTCTCTTTCACCTCTACCCCTCAG
PGK1

000 000 000475 -36A 10 ATAGTAATGCTGTCTATGTATGTGTGCTCTCTC AAAAACAG
2 1443 -39A 3,05 -31A 2 Т AATTAATACTTGTGGCTTTAAAACTTTTCCTAATAG
-29A 1 Т TTAATACTTGTGGCTTTAAAACTTTTCCTAATAG
-25G 1 С TACTTGTGGCTTTAAAACTTTTCCTAATAG
−23G 1 C CTTGTGGCTTTAAAACTTTTCCTAATAG
000 000 000

000

000 -25T 3
-21A 4 Т TTGTCATCTTCCTTCTTTTCCCCCAG
4 487 -26A 2,85 -38T 1 TGGTGTCTCCAGTTTGGACTCTTGCTTACTCTCTTGT CCCTAG
-33A 1 Т TCTCCAGTTTGGACTCTTGCTTACTCTCTTGTCC ГКТД
-23C 1
-16A 1 Т TGCTTACTC TCTTGTCCCTAG
−8G 1 CTCTTGTCCCTAG
0007000
5 781 на -32T 1 —
1
-28C 3
-20A 90 007

1 Т CCCCTACTTACCCTTTTTCATACAG
-18T 1 CCTACTTACCCTTTTTCATACAG
-16A 2 T TACTTACCCTTTTTCATACAG
PKM2 6 1343 −29A 3.10 -39G 1 С CCTCTGTTCTATATAACCTCTCTCCCCCCAACTTTG TCCATCAG
-34A 6 Т GTTCTATATAACCTCTCTCCCCCCAACTTTG TCCATCAG
-32A 2 Т TCTATATAACCTCTCTCCCCCCAACTTTGTCCATCAG
8 4107 на -65T 2 —
−52T 1 AGCTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTC TGGACG40009000 9CTCCCTC TGGACG4CC000 9CTCCCTC TGGACG4CC0009 9CTCC000 9CT0007000 9CT0007000 9CT0007 07

−50A 5 T CTCTGACAAAGCTCTGTCCCCCTCTCGTCCCTCTGGA CGGATGTTGCTCCCCTAG
PKM2 -27T 1
-26C 2
−25A 6 T TACTCACCAACCTCCCTTCTCTTCCTCCAG
PSMB4 4 393 9-404A 9000.05 -44A 4 Т CTGTTATTCAGCCCAATATCCCCCCATGGTTTTCC CCCAATCTCCCTAG
40А 5 Т TATTCAGCCCAATATCCCCCCATGGTTTTCCCCCA ATCTCCCTAG
4 583 -21A 3.30 -26A 1 С ACCCCACTTAACTCTTCTCATTCACCAACAG
-23T 1
−22A 4 T CACTTAACTCTTCTCATTCACCAACAG
000 000 000

000 00030 -22A 9
-20A 1 Т TTAACAACCTGTCTTTCTCTTCTAG
1 2205 -26A 3,55 -22C 7
-8T 1
RPL3 2 770 −21A 3.70 -21A 4 Т GTCTGACTACTGCTTTTTTTTTGCAG
-19T 3
4 1150 −22A 3.30 −24T 10 GGAGCTGAGCTGTGTCTACCTTCTCCTAG
RPL3

000

50 -29T 1
6 477 -34A 3.45 -22T 3
−21A 3 T GCCTTACACCCTTCTTGTTCATTCAG
RPL8 0007 0007 — GTTCCCTGAGGTATCTGATCCCCTACAG
SLC25A3 2 1591 −30A 2.85 -31A 1
1 2929 -24A 3.20 -24A 1 Т GTCTCATCCCTGTCCATTTCTCCTTGCAG
2 тысяча семьсот восемьдесят-семь -34A 3,85 -36T 2 — ACCTCTAACACTTTTTTTGTTCCTTCTAAAC CTCTCTTTAG
-35A 5 CCTCTAACACTTTTTTTGTTCCTTCTAAACC TCTCTTTAG
-34A 2 Т CTCTAACACTTTTTTTGTTCCTTCTAAAC CTCTCTTTAG
3 1808 -34A 9 0007

3.10 -30G 2 CACTGGGCATCAGAGCATATTTGTTTATTT TTCAG
-29G 3 ACTGGGCATCAGAGCATATTTGTTTATTTT TCAG
-28C 1 G CTGGGCATCAGAGCATATTTGTTTATTTTTCAG
-27A 2
4 519 −25A 3.75 -27T 7
-26A 1 Т CTTCTAACTCTTTCTTCTTATGTCCTCTTAG
−25A 5 T TTCTAACTCTTTCTTCTTATGTCCTCTTAG
SNRPB 6 696 95 -27T 8
1 717 -33A 3.45 -30T 6 TGAGGTGACACGCTTATGTTTTACTTTTAAA ГКТД
-29G 1 GAGGTGACACGCTTATGTTTTACTTTTAA ACTAG
-28A 2 Т AGGTGACACGCTTATGTTTTACTTTTAAACTAG

Идентификация точек ветвления и требования к последовательности для сплайсинга интронов у Plasmodium falciparum

Abstract

Сплайсинг мРНК — древний и эволюционно консервативный процесс у эукариотических организмов, но интрон-экзонная структура различается. Plasmodium falciparum имеет экстремальное смещение нуклеотидов AT (> 80%), что дает уникальную возможность исследовать, как эволюционные силы действуют на интронные структуры. В этом исследовании мы разработали анализ репортерного сплайсинга люциферазы in vivo и использовали его в сочетании с выделением лариата и секвенированием для характеристики требований 5′- и 3′-сплайсинга и экспериментального определения точки ветвления интрона в P. falciparum . Этот анализ показывает, что P.falciparum мРНК имеют канонические 5′- и 3′-сайты сплайсинга. Однако 5′-консенсусный мотив является слабо консервативным и допускает нуклеотидную замену, включая пятый нуклеотид в интроне, который, как правило, представляет собой нуклеотид G у большинства эукариот. Для сравнения, 3′-сайт сплайсинга имеет сильную консенсусную последовательность эукариот и прилегающий полипиримидиновый тракт. В четырех различных пре-мРНК P. falciparum были обнаружены множественные точки ветвления на интрон, причем некоторые из них располагались на U вместо типичного остатка A.Слабый консенсус по точкам ветвления был обнаружен среди 18 идентифицированных точек ветвления. Этот анализ показывает, что P. falciparum сохраняет многие консенсусные особенности эукариотических сайтов сплайсинга, несмотря на крайнее смещение кодонов, и обладает гибкостью в нуклеофильной атаке точки ветвления.

ВВЕДЕНИЕ

Интроны — это некодирующие последовательности, расположенные внутри транскриптов мРНК-предшественников (пре-мРНК), которые вырезаются перед экспортом в ядро ​​(39). Сплайсинг пре-мРНК требует мотивов последовательности в интроне и опосредуется рибонуклеопротеидным комплексом, называемым сплайсосомой (37, 53).В то время как фундаментальные механизмы сплайсинга законсервированы среди эукариот (4), мотивы распознавания сайтов сплайсинга короткие и часто слабо консервативны между организмами (20). Кроме того, большая часть программного обеспечения для прогнозирования опирается на модельные организмы, а экспериментальная характеристика сплайсинга интронов у глубоко ветвящихся эукариотических организмов была ограничена (50). Предполагается, что интроны присутствуют примерно в половине генов в геноме Plasmodium falciparum (11). Однако сообщалось о неточностях в предсказании интронов (26, 32, 42). P. falciparum имеет чрезвычайно богатый AT геном (11), который имеет значение как для эволюционной адаптации сплайсосомного аппарата, так и для точности предсказаний генной структуры.

Все сплайсосомные интроны содержат 5′-донорные и 3′-акцепторные сайты сплайсинга, обычно с динуклеотидами GU и AG на соответствующих концах интрона и точкой ветвления, расположенной внутри интрона. Интроны основного класса часто содержат полипиримидиновый тракт, прилегающий к 3′-сайту сплайсинга, который отсутствует в интронах второстепенного класса (29, 39).Во время сплайсинга нуклеотид точки ветвления инициирует нуклеофильную атаку на 5′-донорный сайт сплайсинга. Затем свободный конец вышележащего интрона инициирует вторую нуклеофильную атаку на 3′-акцепторный сайт сплайсинга, высвобождая интрон в виде лариата РНК и ковалентно объединяя два экзона (53). Изменение размера интрона в значительной степени связано с расстоянием от 5′-границы интрона до сайта ответвления. Подавляющее большинство интронов удаляется основной сплайсосомой, большой молекулярной машиной, которая содержит более 70 белков и пять комплексов рибонуклеопротеидов.Каждый комплекс содержит одну из пяти малых ядерных РНК (мяРНК), названных U1, U2, U4, U5 и U6, а также набор общих белков и дополнительных белков, специфичных для отдельных мяРНК (37, 53). Спаривание оснований мяРНК интрона и друг друга, а также взаимодействия белок-белок и белок-РНК факторов сплайсинга позиционируют сайты сплайсинга для сплайсинга (4, 53).

Недавно были идентифицированы пять мяРНК P. falciparum (5, 11, 49). Они похожи на таковые у позвоночных и, по-видимому, способны складываться в одно и то же общее строение (5).5 ‘и 3’ мотивы сайтов сплайсинга для интронов P. falciparum (динуклеотиды GU и AG) следуют общему эукариотическому паттерну (5, 42). Однако менее 10% интронов P. falciparum содержат последовательность, которая соответствует общепринятому консенсусу по консервативным точкам ветвления (20), а точка ветвления P. falciparum до сих пор экспериментально не определена. Поэтому представляет интерес экспериментальная проверка требований к последовательности интрона P. falciparum .

Интроны P. falciparum сравнительно короткие и чрезвычайно богаты АТ, в среднем 179 нуклеотидов (нуклеотидов) и 86,5% А + Т (11). Некоторые из них расположены в конце открытой рамки считывания, добавляя одну аминокислоту (22), или в нетранслируемой области (UTR) (33, 34). Они участвуют в контроле экспрессии гена var (8), и сообщалось о случаях специфической для стадии экспрессии, специфической для пола экспрессии и альтернативного сплайсинга (26, 32, 42). К ним относятся антиген 41-3 (23), поверхностный антиген MAEBL (41), аденилатциклаза с альтернативными AUG из-за паттернов сплайсинга (30), аспартилпротеаза с тремя вариантами (52), антиген SET (для которого сплайсинг регулируется полом в гаметоцитах) (33, 34) и соседних генах с двумя общими 5′-экзонами, которые сплайсированы с разными нижележащими экзонами (51).Недавние оценки альтернативного сплайсинга с помощью анализа RNA-Seq выявили множество дополнительных событий альтернативного сплайсинга в пре-мРНК P. falciparum (32, 42). Таким образом, сплайсинг является ключевым элементом экспрессии генов, который мало изучен у Plasmodium . В этом исследовании мы разработали in vivo анализ репортерного сплайсинга люциферазы и использовали его в сочетании с выделением лариат и секвенированием для характеристики требований 5 ‘и 3’ сплайсинга и экспериментального определения точки ветвления интрона.

МАТЕРИАЛЫ И МЕТОДЫ

Выделение лариата и секвенирование.

РНК выделяли из лизированных сапонином 3D7-инфицированных эритроцитов на смешанных стадиях с использованием TRIzol LS (Invitrogen) и хлороформа в соответствии с инструкциями производителя. РНК (100 нг) инкубировали с ДНКазой I, свободной от РНКазы Ambion, для удаления геномной ДНК. Перед обратной транскрипцией половину РНК обрабатывали 1 мкг РНКазы R в буфере, содержащем 20 мМ Трис-HCl (pH 8,2), 100 мМ KCl и 0,25 мМ MgCl 2 при 37 ° C в течение 60 минут для переваривания линейной РНК и обогащают РНК лариата.Другая половина ложно обрабатывалась только буфером. Для обратной транскрипции использовали обратную транскриптазу SuperScript III (Invitrogen) со смесью 50:50 случайных праймеров и олиго (dT) праймеров, следуя инструкциям производителя. кДНК и РНК лариатные продукты были амплифицированы для четырех различных генов P. falciparum (PF08_0019, PF14_0027, PF10_0155 и PFL0190w) с использованием праймеров для ПЦР, перечисленных в таблице S1 в дополнительном материале. ПЦР выполняли с использованием системы высокоточной ПЦР Expand (Roche PCR) в реакционном объеме 50 мкл, содержащем 1 × буфер для ПЦР с 1.5 мМ MgCl 2, 2 мкМ праймеров, 0,2 мМ дезоксинуклеозидтрифосфатов (dNTP) и 0,05 Ед / мкл полимеразы Taq . Для амплификации кДНК использовали тридцать циклов. Для амплификации лариата вложенные праймеры были сконструированы в дивергентной ориентации, чтобы продукт ПЦР пересекал точку ветвления. За первым циклом ПЦР с 25 циклами следовал второй цикл с 20 циклами, при этом продукт ПЦР очищали между циклами с использованием набора для очистки Qiagen PCR. Продукты ПЦР лариата экстрагировали из агарозных гелей, очищали с помощью набора для экстракции гелей QIAquick (Qiagen), клонировали в вектор T-easy (Promega) и трансфицировали в компетентные клетки Escherichia coli DH5.Плазмиду экстрагировали с помощью мини-набора плазмид (Qiagen) и подвергали секвенированию ДНК.

Конструирование слитых векторов pBtub-fLuc с вариациями интронов для мониторинга сплайсинга мРНК.

Для исследования требований к сплайсингу мРНК в P. falciparum был разработан вектор слияния (pBtubi-fLuc), содержащий последовательность первого интрона и фланкирующего экзона β-тубулина (PF10_0084), слитых с люциферазой светлячка в основной цепи вектора pPf86 (любезно любезно предоставлено Дайаном Виртом и Кевином Милителло) (28).N-концевой слитый вектор β-тубулина (pBtub-fLuc), в котором отсутствует интронная последовательность β-тубулина, был сконструирован в качестве контроля для экспериментов по сплайсингу РНК, и из этого вектора были созданы клоны с вариациями интрона. Конструирование вектора слияния pBtub-fLuc и вариаций интрона подробно описано в разделе «Дополнительные экспериментальные процедуры» в дополнительном материале. В таблице S2 дополнительных материалов перечислены все плазмиды, созданные во время этого исследования, а также последовательность β-тубулина в каждой плазмиде.Плазмиды проверяли секвенированием перед трансфекцией. Типичная плазмидная карта для вектора pBtubi-fLuc показана вместе с последовательностью нативного интрона β-тубулина и фланкирующей последовательностью экзона, используемой при конструировании вектора.

Анализ сплайсинга пре-мРНК в P. falciparum с использованием конструкции слияния β-тубулин-люцифераза. (А) Репортерная конструкция pBtubi1-fluc. Первый интрон гена β-тубулина P. falciparum с окружающими экзонными областями был слит в рамке 5 ‘с репортерным геном люциферазы светлячка.(B) Последовательность β-тубулина, включенного в конструкцию pBtub-fluc. Прописные буквы — последовательность экзона; строчная, интронная последовательность. Возможные альтернативные нуклеотиды 5′-GT и 3’-AG в рамке считывания подчеркнуты. (C к E) Относительное количество активности люциферазы светлячков нормализовали котрансфекцией плазмидой, экспрессирующей люциферазу Renilla . «Без интрона» — это контрольная плазмида слияния, из которой удален интрон β-тубулина. Плазмидные конструкции, помеченные «5mod», представляют собой конструкции, в которых три альтернативных 5′-остатка GT в рамке считывания были заменены нуклеотидами CT.

Культивирование P. falciparum , трансфекция и анализ люциферазы.

D10 паразитов использовали для всех экспериментов по трансфекции и культивировали в стандартных условиях (47) в среде RPMI 1640 с добавлением 0,5% (вес / объем) Albumax II (Invitrogen, Carlsbad, CA) и эритроцитами человека при гематокрите 2%. . Культуры синхронизировали с использованием 5% сорбита (24). Шизонты были выделены с помощью очистки с помощью сортировки магнитно-активированных клеток (MACS) (48) и позволили повторно проникнуть в новые эритроциты в течение 12 часов перед трансфекцией, что привело к появлению эритроцитов, инфицированных на кольцевой стадии с высоким уровнем паразитемии, во время трансфекции.Инфицированные эритроциты подвергали электропорации с использованием Bio-Rad Gene Pulser Xcell с 75 мкг экспериментальной плазмиды и 50 мкг контрольной плазмиды Renilla (любезно предоставленной Дайаном Виртом и Кевином Милителло). Электропорацию проводили в кюветах диаметром 0,2 см с использованием низкого напряжения (0,31 кВ) и высокой емкости (950 мкФ) (9). Трансфектанты поддерживали на среде без фенолового красного и собирали через 16 ч центрифугированием. Лизис паразитов и анализ люциферазы выполняли в соответствии с протоколом производителя с системой анализа двойной люциферазы-репортера (Promega) с использованием однотрубного люминометра Sirius (Berthold).

Секвенирование мРНК конструкции репортера β-тубулина.

РНК собирали экстракцией TRIzol LS (Invitrogen) -1-бром-3-хлорпропан из D10-инфицированных эритроцитов, временно трансфицированных плазмидой pβtubi1-fLuc, содержащей интрон дикого типа. Загрязнение плазмидной ДНК этой РНК было уменьшено обработкой набором Turbo DNA-free (Ambion) и коктейлем рестрикционных ферментов, включая AluI, MnlI и NlaIII (NEB), а также фенол-хлороформом и 1-бром-3- хлорпропановые экстракты.ПЦР с обратной транскрипцией (ОТ-ПЦР) выполняли с использованием реагентов обратной транскрипции TaqMan (Applied Biosystems) и системы высокоточной ПЦР Expand (Roche). ОТ-ПЦР выполняли с использованием прямого праймера в экзоне 1 β-тубулина (5 ‘CATATTCAAGCTGGCCAATGTGGAAATC) и обратного праймера в люциферазе светлячка (5’ AGTTGCTCTCCAGCGGTTCCATC). Продукт выделяли из агарозного геля с использованием геля Wizard SV и системы очистки ПЦР (Promega), а затем клонировали в pGEM-T Easy (Promega). Плазмиды получали с помощью набора FastPlasmid miniprep (5 PRIME) и секвенировали с использованием праймеров SP6 и T7.

Анализ последовательностей

P. falciparum и человеческих интронов.

Последовательности, окружающие 5′-донорные и 3′-акцепторные сайты сплайсинга, были получены с использованием программы для сборки сплайсированных выравниваний (PASA) (15) для сборки тегов экспрессируемой последовательности P. falciparum (EST) в последовательность генома 3D7. EST были получены из двух источников: 14 362 бесполых EST P. falciparum и 5 814 EST гаметоцитов P. falciparum были получены из GenBank, а 7 683 P.falciparum 3D7 EST были получены в лаборатории Гарднера на смешанных бесполых стадиях (З. Ханг и М. Гарднер, неопубликованные данные). Выравнивания PASA дали 3641 P. falciparum EST-подтвержденных последовательностей интронов и последовательностей экзонов, фланкирующих каждый интрон. Данные для 20 000 интронов были получены из набора из 1533 генов человека в базе данных NCBI RefSeq (36). Последовательности длиной в двадцать нуклеотидов, окружающие сайты сплайсинга, были использованы для создания логотипов последовательностей с помощью WebLog 3 (http: // weblogo.threeplusone.com/) (6) с параметрами по умолчанию, за исключением того, что использовалась классическая цветовая схема, а единицы были нанесены на график как «вероятность».

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Биоинформатический анализ

интронов P. falciparum .

Аннотации генома P. falciparum основаны на смеси подтвержденных последовательностью и предсказанных расчетами экзон-интронных структур (11). Поскольку некоторые прогнозы могут быть неточными, PASA использовался для выравнивания и сборки 23 817 P.falciparum EST против генома 3D7, чтобы получить проверенный набор из интронов P. falciparum для анализа. В общей сложности был идентифицирован 3641 EST-подтвержденный интрон (), а также последовательности экзонов, фланкирующие сайты сплайсинга 5 ‘и 3’. Точное соответствие распределений размеров нашего набора данных интронов по сравнению с исходной аннотацией генома (11) указывает на то, что это репрезентативный образец из интронов P. falciparum (). Длина интрона варьировала от 38 нуклеотидов до почти 4 т.п.н., но средний размер невелик: только 20 интронов превышают 1 т.п.н.Анализ позиций, фланкирующих каждое соединение, показывает хорошее совпадение с эукариотическим консенсусом для сайтов сплайсинга. Каноническая 3′-последовательность 5’GU-AG 3 ‘была почти на 100% консервативной, и непосредственно фланкирующие последовательности экзона имели консенсусную последовательность WR для 5′ и RW для 3’-сайта сплайсинга (). В среднем 87% из остатков интрона P. falciparum — это А или Т (11). Это смещение также обычно наблюдается в последовательностях интронов, непосредственно примыкающих к сайтам сплайсинга GT-AG, за исключением того, что положение пятого нуклеотида в 5′-сайте сплайсинга представляет собой равное распределение нуклеотидов A, T или G ().У других организмов нуклеотид G чаще встречается в этой позиции (), поэтому это различие было исследовано в анализе сплайсинга РНК, описанном ниже. Многие интроны сплайсосом U2 имеют полипиримидиновый тракт, непосредственно примыкающий к 3′-сайту сплайсинга, который распознается фактором сплайсинга U2AF 65 . Взаимодействия этого белка с U2AF 35 , который распознает 3′-сайт сплайсинга, и белки, участвующие в распознавании точки ветвления, являются важными элементами для позиционирования компонентов, необходимых для сплайсинга (29). P. falciparum имеет предполагаемые ортологи для U2AF 35 (PF11_0200) и U2AF 65 (PF14_0656), а также других ключевых факторов сплайсинга, и, как и ожидалось, большинство интронов содержат полипиримидиновый тракт, прилегающий к 3′-сплайсингу. консенсусная последовательность сайта (YAGRW). Однако полипиримидиновый тракт P. falciparum содержит меньше нуклеотидов С, чем интроны человека, и имеет больше нуклеотидов А ().

Таблица 1.

0003

Характеристика интрона Значение от:


Аннотированная последовательность (11) Сборки PASA
No. 7,406 3,641
Наибольший (nt) 3,040 3,998
Наименьший (nt) 3 38
9

9

700070006504

Таблица 2.

Последовательности сращивания

50

50

50

9506

9506 Wary a

Место сращивания и характеристика Значение в положении nt (относительно стыка сращивания):


−3 −2 90 −3 1 2 3
5 ′
% от основания:
G 8.9 53,7 100 a 2,8
A 64,2 26,7 0 0007 900 000

19,4 14,4 0 99,7 10,2
C 7,2 5,1 0
П.falciparum W R g u a
Eukaryote A G g 900

% от основания:
G <1 99,5 36 12,3
A 12.1 96,8 39,6 34,7
U 68 15,7 41,7 5,5 10,8
Консенсус
P. falciparum y a g R 00 g G U

Сравнение 5 ‘и 3’ сайтов сращивания WebLogos для людей и P.falciparum . Высота каждой буквы указывает силу предпочтения этого нуклеотида в каждой позиции.

Влияние мутаций 5 ‘и 3’ сайтов сплайсинга на эффективность сплайсинга мРНК у

P. falciparum .

Чтобы исследовать потребности в сплайсинге мРНК в P. falciparum , мы разработали анализ временной трансфекции, в котором экспрессия люциферазы светлячков зависит от правильного сплайсинга интронов (). P. falciparum β-тубулин имеет два коротких интрона длиной 350 и 168 нуклеотидов (11).Первый интрон гена β-тубулина P. falciparum с короткими фланкирующими участками экзона был слит в рамке 5 ‘с репортерным геном люциферазы светлячка (). Интрон содержит стоп-кодоны во всех трех рамках считывания, чтобы остановить трансляцию, если сплайсинг не происходит. Репортерную плазмиду котрансфицировали плазмидой, экспрессирующей люциферазу Renilla , в эритроцитов, инфицированных P. falciparum , для нормализации активности между экспериментами. Конструкция светлячка, содержащая только последовательности экзона β-тубулина без интрона, была включена в качестве положительного контроля.Конструкции, содержащие интроны, и конструкции без интронов производили сходные количества люциферазной активности (и D, первые два столбца). Достоверность анализа сплайсинга проверяли с помощью ОТ-ПЦР и секвенирования сплайсированного продукта слияния мРНК, который, как было обнаружено, был сплайсирован на ожидаемых участках нативного гена β-тубулина (данные не показаны).

Чтобы исследовать требования к последовательностям для эффективного распознавания сайтов сплайсинга, был приготовлен ряд плазмид, содержащих модифицированные последовательности β-тубулина, и протестирован в анализе сплайсинга.В 3′-сайте сплайсинга нативная последовательность agAG была мутирована на tcAG и acAG (последовательности интронов указаны в нижнем регистре). Оба изменения полностью исключают активность люциферазы светлячков (). Для сравнения, мутация 5′-сайта сплайсинга от CAgt к CAct значительно снижала, но не отменяла люциферазную активность (, столбец 3), возможно, из-за присутствия потенциальных альтернативных 5′-сайтов сплайсинга как перед, так и после границы экзон-интрон. (подчеркнутые ГТ).

Первый интрон в P.falciparum β-тубулин имеет редкий 5′-акцепторный сайт сплайсинга, CAgt (). Одним из потенциальных альтернативных сайтов сплайсинга в рамке считывания может быть гораздо более распространенный 5′-акцепторный сайт сплайсинга AAgt (). Чтобы исследовать особенности последовательности, которые влияют на распознавание 5′-сплайсинга в P. falciparum , мы мутировали AAgt и два других потенциальных альтернативных сайта сплайсинга с GT на CT (подчеркнутые нуклеотиды), сохранив при этом нативный 5′-сайт сплайсинга (конструкция 5mod CAgt) . Эта комбинация мутаций только частично снижает активность люциферазы (, столбец 4), указывая на то, что нативный сайт является предпочтительным сайтом узнавания в репортерной конструкции, несмотря на то, что он является редким типом.Мутация нативного 5′-сайта сплайсинга в дополнение к возможным альтернативным сайтам снижает активность люциферазы почти до фоновых уровней (столбец 5). Интересно, что существуют также альтернативные последовательности AG в рамке считывания, расположенные ниже 3′-сайта сплайсинга (подчеркнутые AG). Они, по-видимому, не способны компенсировать потерю 3′-сайта сплайсинга, вероятно потому, что они не соседствуют с полипиримидиновым трактом () и поэтому не распознаются U2AF 65 . Взятые вместе, эти данные показывают, что P.falciparum имеет традиционные мотивы сайтов сплайсинга 5’GU-AG3 ‘.

Таблица 3.

5 ‘Частоты сплайсинга

0007

9007

70007

4

975 35

Последовательность a No.

662
ATgt 350
ACgt 119
GAgt 93
GGgt 169
TAgt 125
TGgt 455
TTgt 96
TCgt 30
30
6 9750
CTgt 32
CCgt 21

Для дальнейшего изучения того, насколько редкие последовательности распознавания 5′-сплайсинга распознаются P.falciparum , мы также исследовали роль экзонной последовательности в эффективности сплайсинга. Неожиданно мутация стороны экзона 5′-сайта сплайсинга с нативного CAgt на более распространенный AGgt или чрезвычайно редкий GCgt () оба привели к значительному увеличению активности люциферазы (столбцы 6 и 7). Таким образом, основным фактором, определяющим предпочтение сайта сплайсинга для этого интрона, является не непосредственно предшествующий динуклеотид экзона, а, вероятно, другие особенности фланкирующей последовательности экзона или интрона.Эти данные также предполагают, что последовательности экзона, непосредственно предшествующие интрону, могут влиять на эффективность сплайсинга или иным образом влиять на уровни белка. Все 16 динуклеотидных комбинаций встречаются, по крайней мере, изредка до интронов P. falciparum (). Возможность того, что они могут играть роль в регуляции экспрессии, интригует.

У человека и Saccharomyces cerevisiae (5) пятая позиция интрона является высококонсервативной G. Напротив, A, G и T одинаково распространены в этой позиции у P.falciparum (), несмотря на то, что остатки мяРНК U1 и U6, предположительно взаимодействующие с этим положением (25, 40), не изменяются между S. cerevisiae и P. falciparum (5). Было показано, что мутация G5 в S. cerevisiae снижает эффективность сплайсинга (10) и является второй ведущей причиной активации новых аберрантных 5′-сайтов сплайсинга при генетических заболеваниях человека, включая бета-талассемию, нейроакантоцитозный синдром МакЛеода и Мышечная дистрофия Дюшенна (1, 3, 7, 46).Чтобы проверить, влияет ли пятый нуклеотид также на активность сплайсинга в P. falciparum , мы мутировали этот остаток с G (нативный остаток в первом интроне ß-тубулина) на A или T. Оба являются общими в этом положении в P. .falciparum и гораздо реже встречаются у человека () или S. cerevisiae (39). Эти мутации были сделаны в конструкции плазмиды β-тубулина, в которой возможные альтернативные 5′-сайты сплайсинга были мутированы, чтобы гарантировать использование нативного 5′-сайта сплайсинга.Неожиданно конструкции с заменой A имели сплайсинговую активность, сравнимую с таковой у нативной конструкции G, в то время как замена T приводила к увеличению (). Следовательно, P. falciparum относительно толерантен к заменам A или T в этом месте, несмотря на тот факт, что остатки U1 и U6, которые, как предполагается, будут взаимодействовать с этим нуклеотидом, должны предпочтительно пара оснований с G в положении 5 (5).

P. falciparum Идентификация точки ветвления и согласованный мотив сайта ветвления.

На первом этапе сплайсинга пре-мРНК сборка сплайсосом включает спаривание оснований между последовательностью в U2 мяРНК и точкой ветвления (4, 53). У большинства эукариот точка ветвления обычно расположена около 5′-конца полипиримидинового тракта и пар оснований с 6-нуклеотидным мотивом в мяРНК U2 (4, 53). Например, интронов S. cerevisiae содержат по одной точке ветвления на расстоянии от 10 до 155 нуклеотидов перед 3′-сайтом сплайсинга. Эта точка ветвления (подчеркнутый A) расположена внутри высококонсервативной последовательности UACUAAC и пар оснований с 8-нуклеотидной последовательностью мяРНК U2 (43).Точка ветвления у млекопитающих находится в менее консервативной последовательности YURAY, обычно на 18–37 нуклеотидов выше 3′-сайта сплайсинга (39, 53). Несмотря на то, что последовательность мяРНК U2 P. falciparum идентична последовательности мяРНК S. cerevisiae и U2 человека в области взаимодействия точки ветвления (5), менее 10% интронов P. falciparum имеют очевидная консенсусная последовательность точки ветвления, аналогичная таковой у S. cerevisiae или человека (39). Поэтому экспериментально определены точки ветвления для четырех P.falciparum интронов.

Во время сплайсинга две последовательные переэтерификации производят лариат РНК. Лариаты образуются из пре-мРНК в результате нуклеофильной атаки выпуклого A в точке ветвления на 5′-донорском сайте сплайсинга. Это создает связь 2′-5 ‘, а не типичную связь 3′-5’, образуя кольцевую РНК с коротким линейным хвостом (53). РНК-лариаты недолговечны, но их можно обнаружить при низкой концентрации в общей РНК (44). Используя вложенные праймеры в дивергентной ориентации, можно получить продукты ОТ-ПЦР, которые пересекают точку ветвления ().Мы сосредоточились на генах с умеренной или высокой степенью экспрессии, чтобы увеличить вероятность обнаружения интронных лариатов. Выбор интрона в каждом гене определялся размером и последовательностью интрона. Были получены продукты ОТ-ПЦР для четырех интронов P. falciparum . Их клонировали и секвенировали, и точку ветвления идентифицировали путем сравнения с последовательностью геномной ДНК. Всего было выявлено 18 филиалов (). Неожиданно было обнаружено несколько точек ветвления для всех четырех интронов, и были обнаружены точки ветвления A и U, хотя точки ветвления A преобладали (14 из 18).В качестве контроля анализировали точки ветвления интрона человеческого β-глобина и интрона S. cerevisiae рибосомного белка. Для обоих все клоны имели одну и ту же точку ветвления, расположенную в точке A (данные не показаны). Этот подход, то есть ПЦР-амплификация через точку ветвления, также недавно был использован для идентификации точек ветвления для транс -сплайсированных РНК Trypanosoma brucei . Здесь также было обнаружено несколько точек ветвления на интрон (27). Большинство из них были точками ветвления A, но наблюдались точки ветвления C.Хотя они менее распространены, для сплайсинга cis сообщалось о точках ветвления U или C (12, 13, 16).

Резюме картирования точек ветвления в P. falciparum . (A) Схема подхода RT-PCR для картирования точек ветвления в четырех интронах P. falciparum . (B) Агарозный гель продуктов ПЦР, амплифицированных из РНК-лариатов рецептора активированного гомолога С-киназы (PfRACK, PF08_0019). + или — указывает, был ли образец РНК обработан РНКазой R перед обратной транскрипцией.М — ДНК-маркер; мР, мРНК; лар, лариат. Слева указаны размеры ДНК-маркеров в парах оснований. (C) Экспериментально определенные точки ветвления обозначены подчеркнутыми буквами. Указано расстояние каждой точки ветвления от 3′-сайта сплайсинга. (D) Сводная информация о точках разветвления.

У P. falciparum точки ветвления располагались от 23 до 57 нуклеотидов выше по течению от сайта 3′-сплайсинга (). Сравнение 18 точек ветвления выявило консенсусный мотив YWHWW (), который связан с консенсусной последовательностью человека (YURAY), но имеет большее смещение A / T и менее консервативен.Хотя сайт взаимодействия точки ветвления в мяРНК P. falciparum U2 является обычным (5), нам не удалось найти сильный потенциал спаривания оснований между U2 и наблюдаемыми точками ветвления P. falciparum .

Консенсусные последовательности, обнаруженные в интронах P. falciparum . (A) WebLogo для 18 точек ветвления, идентифицированных в четырех последовательностях P. falciparum . (B) Указаны консенсусные последовательности в сайтах сплайсинга 5 ‘и 3′ и последовательности точек ветвления. Пороговые значения для консенсусных последовательностей 5′- и 3’-сайтов сплайсинга были установлены на уровне 20%, а для точки ветвления — на 10%, поскольку последовательностей было меньше.Показано расстояние между 3 ‘местом соединения и точкой ветвления. W = A или T, R = A или G, D = T, или A, или G, Y = C или T, и H = C, или A, или T.

Спаривание оснований между мяРНК и последовательностями интронов является ключевым элементом для обеспечения сайты сплайсинга 5 ‘и 3’ сближаются, позволяя происходить переэтерификации. МяРНК образуют комплекс с белками, некоторые из которых также распознают и связывают интронные мотивы и другие белки, способствуя правильному позиционированию (14, 38, 45, 53). Эти элементы взаимодействуют и могут компенсировать мутацию или потерю другого.Мотивы консенсуса точки ветвления обычно сильнее у организмов с бедными интронами и слабее у организмов, богатых интронами (21). Точки ветвления у некоторых организмов, особенно у Caenorhabditis elegans , не обладают сильной комплементарностью U2. Вместо этого последние восемь нуклеотидов интронов C. elegans являются высококонсервативными, распознаются и связываются белковыми компонентами U2 snRNP, U2AF 35 и U2AF 65 (17, 55, 56), правильно позиционируя интрон и U2 мяРНК. С.cerevisiae не имеет ортолога U2AF 35 , а в его интронах отсутствует полипиримидиновый тракт, сайт связывания для его ортолога U2AF 65 . Однако жестко консервативная последовательность точки ветвления UACUAAC в S. cerevisiae (35, 54) обеспечивает более длинную область комплементарности с U2, чем это характерно для богатых интронами организмов. Поддержание точного позиционирования с учетом этих различий может способствовать сильной сохранности мотивов, чтобы обеспечить «якорь» для оборудования сращивания. Эти точки указывают на возможность компенсаторных изменений у P.falciparum , чтобы разместить мотив слабой точки ветвления.

Заключение.

Сравнительная геномика показала, что сила консенсусных последовательностей интронов варьируется в зависимости от эукариотических организмов (39). P. falciparum имеет одно из самых высоких содержаний AT (81%) среди всех секвенированных геномов (21) и, следовательно, представляет уникальную возможность исследовать адаптацию сплайсосом в глубоко ветвящемся эукариотическом организме с экстремальным смещением последовательности AT. За редким исключением (42, 50), интроны сплайсосом U2 характеризуются границами интронов 5’GU-AG3 ‘.Эти канонические особенности также сохраняются в P. falciparum , но с сильной консервацией мотивов границ интрона 5 ‘(WR / GUAADW) и 3′ (UAGRW). Соседний 3’-полипиримидиновый тракт имеет меньше нуклеотидов C в P. falciparum , чем в интронах человека (). Предсказанные традиционные мотивы точек ветвления редки у P. falciparum (42), и наши данные указывают на то, что консенсусный мотив точки ветвления является относительно слабым, со значительной толерантностью к заменам A / U.Примечательно, что было обнаружено несколько точек ветвления на интрон, причем некоторые из них располагались на остатках U вместо A. Точки ветвления, отличные от A, и множественные точки ветвления в интроне встречаются редко, но о них сообщалось ранее (16, 27), а использование альтернативных точек ветвления является фактором некоторых альтернативных сплайсинга (18, 19) и генетических заболеваний человека (2 , 31). Об альтернативном сплайсинге сообщалось у P. falciparum (32, 42), но неизвестно, являются ли альтернативные точки ветвления факторами в любом из этих случаев.

Секвенирование генома P. falciparum и анализ его транскриптома привели к появлению множества статей, оценивающих предсказанные интроны и консервативные последовательности. В этом исследовании мы перешли от прогнозов к экспериментальной оценке особенностей последовательности интронов, которые влияют на эффективность сплайсинга у P. falciparum . Наши данные подтверждают некоторые ожидаемые особенности сплайсинга эукариот и определяют неожиданную гибкость в мотиве точки ветвления и выборе места ветвления.

Идентификация точек ветвления и требования к последовательности для сплайсинга интронов у Plasmodium falciparum

Abstract

Сплайсинг мРНК — древний и эволюционно консервативный процесс у эукариотических организмов, но интрон-экзонная структура различается. Plasmodium falciparum имеет экстремальное смещение нуклеотидов AT (> 80%), что дает уникальную возможность исследовать, как эволюционные силы действуют на интронные структуры. В этом исследовании мы разработали анализ репортерного сплайсинга люциферазы in vivo и использовали его в сочетании с выделением лариата и секвенированием для характеристики требований 5′- и 3′-сплайсинга и экспериментального определения точки ветвления интрона в P.falciparum . Этот анализ показывает, что мРНК P. falciparum имеют канонические 5′- и 3′-сайты сплайсинга. Однако 5′-консенсусный мотив является слабо консервативным и допускает нуклеотидную замену, включая пятый нуклеотид в интроне, который, как правило, представляет собой нуклеотид G у большинства эукариот. Для сравнения, 3′-сайт сплайсинга имеет сильную консенсусную последовательность эукариот и прилегающий полипиримидиновый тракт. В четырех различных пре-мРНК P. falciparum были обнаружены множественные точки ветвления на интрон, причем некоторые из них располагались на U вместо типичного остатка A.Слабый консенсус по точкам ветвления был обнаружен среди 18 идентифицированных точек ветвления. Этот анализ показывает, что P. falciparum сохраняет многие консенсусные особенности эукариотических сайтов сплайсинга, несмотря на крайнее смещение кодонов, и обладает гибкостью в нуклеофильной атаке точки ветвления.

ВВЕДЕНИЕ

Интроны — это некодирующие последовательности, расположенные внутри транскриптов мРНК-предшественников (пре-мРНК), которые вырезаются перед экспортом в ядро ​​(39). Сплайсинг пре-мРНК требует мотивов последовательности в интроне и опосредуется рибонуклеопротеидным комплексом, называемым сплайсосомой (37, 53).В то время как фундаментальные механизмы сплайсинга законсервированы среди эукариот (4), мотивы распознавания сайтов сплайсинга короткие и часто слабо консервативны между организмами (20). Кроме того, большая часть программного обеспечения для прогнозирования опирается на модельные организмы, а экспериментальная характеристика сплайсинга интронов у глубоко ветвящихся эукариотических организмов была ограничена (50). Предполагается, что интроны присутствуют примерно в половине генов в геноме Plasmodium falciparum (11). Однако сообщалось о неточностях в предсказании интронов (26, 32, 42). P. falciparum имеет чрезвычайно богатый AT геном (11), который имеет значение как для эволюционной адаптации сплайсосомного аппарата, так и для точности предсказаний генной структуры.

Все сплайсосомные интроны содержат 5′-донорные и 3′-акцепторные сайты сплайсинга, обычно с динуклеотидами GU и AG на соответствующих концах интрона и точкой ветвления, расположенной внутри интрона. Интроны основного класса часто содержат полипиримидиновый тракт, прилегающий к 3′-сайту сплайсинга, который отсутствует в интронах второстепенного класса (29, 39).Во время сплайсинга нуклеотид точки ветвления инициирует нуклеофильную атаку на 5′-донорный сайт сплайсинга. Затем свободный конец вышележащего интрона инициирует вторую нуклеофильную атаку на 3′-акцепторный сайт сплайсинга, высвобождая интрон в виде лариата РНК и ковалентно объединяя два экзона (53). Изменение размера интрона в значительной степени связано с расстоянием от 5′-границы интрона до сайта ответвления. Подавляющее большинство интронов удаляется основной сплайсосомой, большой молекулярной машиной, которая содержит более 70 белков и пять комплексов рибонуклеопротеидов.Каждый комплекс содержит одну из пяти малых ядерных РНК (мяРНК), названных U1, U2, U4, U5 и U6, а также набор общих белков и дополнительных белков, специфичных для отдельных мяРНК (37, 53). Спаривание оснований мяРНК интрона и друг друга, а также взаимодействия белок-белок и белок-РНК факторов сплайсинга позиционируют сайты сплайсинга для сплайсинга (4, 53).

Недавно были идентифицированы пять мяРНК P. falciparum (5, 11, 49). Они похожи на таковые у позвоночных и, по-видимому, способны складываться в одно и то же общее строение (5).5 ‘и 3’ мотивы сайтов сплайсинга для интронов P. falciparum (динуклеотиды GU и AG) следуют общему эукариотическому паттерну (5, 42). Однако менее 10% интронов P. falciparum содержат последовательность, которая соответствует общепринятому консенсусу по консервативным точкам ветвления (20), а точка ветвления P. falciparum до сих пор экспериментально не определена. Поэтому представляет интерес экспериментальная проверка требований к последовательности интрона P. falciparum .

Интроны P. falciparum сравнительно короткие и чрезвычайно богаты АТ, в среднем 179 нуклеотидов (нуклеотидов) и 86,5% А + Т (11). Некоторые из них расположены в конце открытой рамки считывания, добавляя одну аминокислоту (22), или в нетранслируемой области (UTR) (33, 34). Они участвуют в контроле экспрессии гена var (8), и сообщалось о случаях специфической для стадии экспрессии, специфической для пола экспрессии и альтернативного сплайсинга (26, 32, 42). К ним относятся антиген 41-3 (23), поверхностный антиген MAEBL (41), аденилатциклаза с альтернативными AUG из-за паттернов сплайсинга (30), аспартилпротеаза с тремя вариантами (52), антиген SET (для которого сплайсинг регулируется полом в гаметоцитах) (33, 34) и соседних генах с двумя общими 5′-экзонами, которые сплайсированы с разными нижележащими экзонами (51).Недавние оценки альтернативного сплайсинга с помощью анализа RNA-Seq выявили множество дополнительных событий альтернативного сплайсинга в пре-мРНК P. falciparum (32, 42). Таким образом, сплайсинг является ключевым элементом экспрессии генов, который мало изучен у Plasmodium . В этом исследовании мы разработали in vivo анализ репортерного сплайсинга люциферазы и использовали его в сочетании с выделением лариат и секвенированием для характеристики требований 5 ‘и 3’ сплайсинга и экспериментального определения точки ветвления интрона.

МАТЕРИАЛЫ И МЕТОДЫ

Выделение лариата и секвенирование.

РНК выделяли из лизированных сапонином 3D7-инфицированных эритроцитов на смешанных стадиях с использованием TRIzol LS (Invitrogen) и хлороформа в соответствии с инструкциями производителя. РНК (100 нг) инкубировали с ДНКазой I, свободной от РНКазы Ambion, для удаления геномной ДНК. Перед обратной транскрипцией половину РНК обрабатывали 1 мкг РНКазы R в буфере, содержащем 20 мМ Трис-HCl (pH 8,2), 100 мМ KCl и 0,25 мМ MgCl 2 при 37 ° C в течение 60 минут для переваривания линейной РНК и обогащают РНК лариата.Другая половина ложно обрабатывалась только буфером. Для обратной транскрипции использовали обратную транскриптазу SuperScript III (Invitrogen) со смесью 50:50 случайных праймеров и олиго (dT) праймеров, следуя инструкциям производителя. кДНК и РНК лариатные продукты были амплифицированы для четырех различных генов P. falciparum (PF08_0019, PF14_0027, PF10_0155 и PFL0190w) с использованием праймеров для ПЦР, перечисленных в таблице S1 в дополнительном материале. ПЦР выполняли с использованием системы высокоточной ПЦР Expand (Roche PCR) в реакционном объеме 50 мкл, содержащем 1 × буфер для ПЦР с 1.5 мМ MgCl 2, 2 мкМ праймеров, 0,2 мМ дезоксинуклеозидтрифосфатов (dNTP) и 0,05 Ед / мкл полимеразы Taq . Для амплификации кДНК использовали тридцать циклов. Для амплификации лариата вложенные праймеры были сконструированы в дивергентной ориентации, чтобы продукт ПЦР пересекал точку ветвления. За первым циклом ПЦР с 25 циклами следовал второй цикл с 20 циклами, при этом продукт ПЦР очищали между циклами с использованием набора для очистки Qiagen PCR. Продукты ПЦР лариата экстрагировали из агарозных гелей, очищали с помощью набора для экстракции гелей QIAquick (Qiagen), клонировали в вектор T-easy (Promega) и трансфицировали в компетентные клетки Escherichia coli DH5.Плазмиду экстрагировали с помощью мини-набора плазмид (Qiagen) и подвергали секвенированию ДНК.

Конструирование слитых векторов pBtub-fLuc с вариациями интронов для мониторинга сплайсинга мРНК.

Для исследования требований к сплайсингу мРНК в P. falciparum был разработан вектор слияния (pBtubi-fLuc), содержащий последовательность первого интрона и фланкирующего экзона β-тубулина (PF10_0084), слитых с люциферазой светлячка в основной цепи вектора pPf86 (любезно любезно предоставлено Дайаном Виртом и Кевином Милителло) (28).N-концевой слитый вектор β-тубулина (pBtub-fLuc), в котором отсутствует интронная последовательность β-тубулина, был сконструирован в качестве контроля для экспериментов по сплайсингу РНК, и из этого вектора были созданы клоны с вариациями интрона. Конструирование вектора слияния pBtub-fLuc и вариаций интрона подробно описано в разделе «Дополнительные экспериментальные процедуры» в дополнительном материале. В таблице S2 дополнительных материалов перечислены все плазмиды, созданные во время этого исследования, а также последовательность β-тубулина в каждой плазмиде.Плазмиды проверяли секвенированием перед трансфекцией. Типичная плазмидная карта для вектора pBtubi-fLuc показана вместе с последовательностью нативного интрона β-тубулина и фланкирующей последовательностью экзона, используемой при конструировании вектора.

Анализ сплайсинга пре-мРНК в P. falciparum с использованием конструкции слияния β-тубулин-люцифераза. (А) Репортерная конструкция pBtubi1-fluc. Первый интрон гена β-тубулина P. falciparum с окружающими экзонными областями был слит в рамке 5 ‘с репортерным геном люциферазы светлячка.(B) Последовательность β-тубулина, включенного в конструкцию pBtub-fluc. Прописные буквы — последовательность экзона; строчная, интронная последовательность. Возможные альтернативные нуклеотиды 5′-GT и 3’-AG в рамке считывания подчеркнуты. (C к E) Относительное количество активности люциферазы светлячков нормализовали котрансфекцией плазмидой, экспрессирующей люциферазу Renilla . «Без интрона» — это контрольная плазмида слияния, из которой удален интрон β-тубулина. Плазмидные конструкции, помеченные «5mod», представляют собой конструкции, в которых три альтернативных 5′-остатка GT в рамке считывания были заменены нуклеотидами CT.

Культивирование P. falciparum , трансфекция и анализ люциферазы.

D10 паразитов использовали для всех экспериментов по трансфекции и культивировали в стандартных условиях (47) в среде RPMI 1640 с добавлением 0,5% (вес / объем) Albumax II (Invitrogen, Carlsbad, CA) и эритроцитами человека при гематокрите 2%. . Культуры синхронизировали с использованием 5% сорбита (24). Шизонты были выделены с помощью очистки с помощью сортировки магнитно-активированных клеток (MACS) (48) и позволили повторно проникнуть в новые эритроциты в течение 12 часов перед трансфекцией, что привело к появлению эритроцитов, инфицированных на кольцевой стадии с высоким уровнем паразитемии, во время трансфекции.Инфицированные эритроциты подвергали электропорации с использованием Bio-Rad Gene Pulser Xcell с 75 мкг экспериментальной плазмиды и 50 мкг контрольной плазмиды Renilla (любезно предоставленной Дайаном Виртом и Кевином Милителло). Электропорацию проводили в кюветах диаметром 0,2 см с использованием низкого напряжения (0,31 кВ) и высокой емкости (950 мкФ) (9). Трансфектанты поддерживали на среде без фенолового красного и собирали через 16 ч центрифугированием. Лизис паразитов и анализ люциферазы выполняли в соответствии с протоколом производителя с системой анализа двойной люциферазы-репортера (Promega) с использованием однотрубного люминометра Sirius (Berthold).

Секвенирование мРНК конструкции репортера β-тубулина.

РНК собирали экстракцией TRIzol LS (Invitrogen) -1-бром-3-хлорпропан из D10-инфицированных эритроцитов, временно трансфицированных плазмидой pβtubi1-fLuc, содержащей интрон дикого типа. Загрязнение плазмидной ДНК этой РНК было уменьшено обработкой набором Turbo DNA-free (Ambion) и коктейлем рестрикционных ферментов, включая AluI, MnlI и NlaIII (NEB), а также фенол-хлороформом и 1-бром-3- хлорпропановые экстракты.ПЦР с обратной транскрипцией (ОТ-ПЦР) выполняли с использованием реагентов обратной транскрипции TaqMan (Applied Biosystems) и системы высокоточной ПЦР Expand (Roche). ОТ-ПЦР выполняли с использованием прямого праймера в экзоне 1 β-тубулина (5 ‘CATATTCAAGCTGGCCAATGTGGAAATC) и обратного праймера в люциферазе светлячка (5’ AGTTGCTCTCCAGCGGTTCCATC). Продукт выделяли из агарозного геля с использованием геля Wizard SV и системы очистки ПЦР (Promega), а затем клонировали в pGEM-T Easy (Promega). Плазмиды получали с помощью набора FastPlasmid miniprep (5 PRIME) и секвенировали с использованием праймеров SP6 и T7.

Анализ последовательностей

P. falciparum и человеческих интронов.

Последовательности, окружающие 5′-донорные и 3′-акцепторные сайты сплайсинга, были получены с использованием программы для сборки сплайсированных выравниваний (PASA) (15) для сборки тегов экспрессируемой последовательности P. falciparum (EST) в последовательность генома 3D7. EST были получены из двух источников: 14 362 бесполых EST P. falciparum и 5 814 EST гаметоцитов P. falciparum были получены из GenBank, а 7 683 P.falciparum 3D7 EST были получены в лаборатории Гарднера на смешанных бесполых стадиях (З. Ханг и М. Гарднер, неопубликованные данные). Выравнивания PASA дали 3641 P. falciparum EST-подтвержденных последовательностей интронов и последовательностей экзонов, фланкирующих каждый интрон. Данные для 20 000 интронов были получены из набора из 1533 генов человека в базе данных NCBI RefSeq (36). Последовательности длиной в двадцать нуклеотидов, окружающие сайты сплайсинга, были использованы для создания логотипов последовательностей с помощью WebLog 3 (http: // weblogo.threeplusone.com/) (6) с параметрами по умолчанию, за исключением того, что использовалась классическая цветовая схема, а единицы были нанесены на график как «вероятность».

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Биоинформатический анализ

интронов P. falciparum .

Аннотации генома P. falciparum основаны на смеси подтвержденных последовательностью и предсказанных расчетами экзон-интронных структур (11). Поскольку некоторые прогнозы могут быть неточными, PASA использовался для выравнивания и сборки 23 817 P.falciparum EST против генома 3D7, чтобы получить проверенный набор из интронов P. falciparum для анализа. В общей сложности был идентифицирован 3641 EST-подтвержденный интрон (), а также последовательности экзонов, фланкирующие сайты сплайсинга 5 ‘и 3’. Точное соответствие распределений размеров нашего набора данных интронов по сравнению с исходной аннотацией генома (11) указывает на то, что это репрезентативный образец из интронов P. falciparum (). Длина интрона варьировала от 38 нуклеотидов до почти 4 т.п.н., но средний размер невелик: только 20 интронов превышают 1 т.п.н.Анализ позиций, фланкирующих каждое соединение, показывает хорошее совпадение с эукариотическим консенсусом для сайтов сплайсинга. Каноническая 3′-последовательность 5’GU-AG 3 ‘была почти на 100% консервативной, и непосредственно фланкирующие последовательности экзона имели консенсусную последовательность WR для 5′ и RW для 3’-сайта сплайсинга (). В среднем 87% из остатков интрона P. falciparum — это А или Т (11). Это смещение также обычно наблюдается в последовательностях интронов, непосредственно примыкающих к сайтам сплайсинга GT-AG, за исключением того, что положение пятого нуклеотида в 5′-сайте сплайсинга представляет собой равное распределение нуклеотидов A, T или G ().У других организмов нуклеотид G чаще встречается в этой позиции (), поэтому это различие было исследовано в анализе сплайсинга РНК, описанном ниже. Многие интроны сплайсосом U2 имеют полипиримидиновый тракт, непосредственно примыкающий к 3′-сайту сплайсинга, который распознается фактором сплайсинга U2AF 65 . Взаимодействия этого белка с U2AF 35 , который распознает 3′-сайт сплайсинга, и белки, участвующие в распознавании точки ветвления, являются важными элементами для позиционирования компонентов, необходимых для сплайсинга (29). P. falciparum имеет предполагаемые ортологи для U2AF 35 (PF11_0200) и U2AF 65 (PF14_0656), а также других ключевых факторов сплайсинга, и, как и ожидалось, большинство интронов содержат полипиримидиновый тракт, прилегающий к 3′-сплайсингу. консенсусная последовательность сайта (YAGRW). Однако полипиримидиновый тракт P. falciparum содержит меньше нуклеотидов С, чем интроны человека, и имеет больше нуклеотидов А ().

Таблица 1.

0003

Характеристика интрона Значение от:


Аннотированная последовательность (11) Сборки PASA
No. 7,406 3,641
Наибольший (nt) 3,040 3,998
Наименьший (nt) 3 38
9

9

700070006504

Таблица 2.

Последовательности сращивания

50

50

50

9506

9506 Wary a

Место сращивания и характеристика Значение в положении nt (относительно стыка сращивания):


−3 −2 90 −3 1 2 3
5 ′
% от основания:
G 8.9 53,7 100 a 2,8
A 64,2 26,7 0 0007 900 000

19,4 14,4 0 99,7 10,2
C 7,2 5,1 0
П.falciparum W R g u a
Eukaryote A G g 900

% от основания:
G <1 99,5 36 12,3
A 12.1 96,8 39,6 34,7
U 68 15,7 41,7 5,5 10,8
Консенсус
P. falciparum y a g R 00 g G U

Сравнение 5 ‘и 3’ сайтов сращивания WebLogos для людей и P.falciparum . Высота каждой буквы указывает силу предпочтения этого нуклеотида в каждой позиции.

Влияние мутаций 5 ‘и 3’ сайтов сплайсинга на эффективность сплайсинга мРНК у

P. falciparum .

Чтобы исследовать потребности в сплайсинге мРНК в P. falciparum , мы разработали анализ временной трансфекции, в котором экспрессия люциферазы светлячков зависит от правильного сплайсинга интронов (). P. falciparum β-тубулин имеет два коротких интрона длиной 350 и 168 нуклеотидов (11).Первый интрон гена β-тубулина P. falciparum с короткими фланкирующими участками экзона был слит в рамке 5 ‘с репортерным геном люциферазы светлячка (). Интрон содержит стоп-кодоны во всех трех рамках считывания, чтобы остановить трансляцию, если сплайсинг не происходит. Репортерную плазмиду котрансфицировали плазмидой, экспрессирующей люциферазу Renilla , в эритроцитов, инфицированных P. falciparum , для нормализации активности между экспериментами. Конструкция светлячка, содержащая только последовательности экзона β-тубулина без интрона, была включена в качестве положительного контроля.Конструкции, содержащие интроны, и конструкции без интронов производили сходные количества люциферазной активности (и D, первые два столбца). Достоверность анализа сплайсинга проверяли с помощью ОТ-ПЦР и секвенирования сплайсированного продукта слияния мРНК, который, как было обнаружено, был сплайсирован на ожидаемых участках нативного гена β-тубулина (данные не показаны).

Чтобы исследовать требования к последовательностям для эффективного распознавания сайтов сплайсинга, был приготовлен ряд плазмид, содержащих модифицированные последовательности β-тубулина, и протестирован в анализе сплайсинга.В 3′-сайте сплайсинга нативная последовательность agAG была мутирована на tcAG и acAG (последовательности интронов указаны в нижнем регистре). Оба изменения полностью исключают активность люциферазы светлячков (). Для сравнения, мутация 5′-сайта сплайсинга от CAgt к CAct значительно снижала, но не отменяла люциферазную активность (, столбец 3), возможно, из-за присутствия потенциальных альтернативных 5′-сайтов сплайсинга как перед, так и после границы экзон-интрон. (подчеркнутые ГТ).

Первый интрон в P.falciparum β-тубулин имеет редкий 5′-акцепторный сайт сплайсинга, CAgt (). Одним из потенциальных альтернативных сайтов сплайсинга в рамке считывания может быть гораздо более распространенный 5′-акцепторный сайт сплайсинга AAgt (). Чтобы исследовать особенности последовательности, которые влияют на распознавание 5′-сплайсинга в P. falciparum , мы мутировали AAgt и два других потенциальных альтернативных сайта сплайсинга с GT на CT (подчеркнутые нуклеотиды), сохранив при этом нативный 5′-сайт сплайсинга (конструкция 5mod CAgt) . Эта комбинация мутаций только частично снижает активность люциферазы (, столбец 4), указывая на то, что нативный сайт является предпочтительным сайтом узнавания в репортерной конструкции, несмотря на то, что он является редким типом.Мутация нативного 5′-сайта сплайсинга в дополнение к возможным альтернативным сайтам снижает активность люциферазы почти до фоновых уровней (столбец 5). Интересно, что существуют также альтернативные последовательности AG в рамке считывания, расположенные ниже 3′-сайта сплайсинга (подчеркнутые AG). Они, по-видимому, не способны компенсировать потерю 3′-сайта сплайсинга, вероятно потому, что они не соседствуют с полипиримидиновым трактом () и поэтому не распознаются U2AF 65 . Взятые вместе, эти данные показывают, что P.falciparum имеет традиционные мотивы сайтов сплайсинга 5’GU-AG3 ‘.

Таблица 3.

5 ‘Частоты сплайсинга

0007

9007

70007

4

975 35

Последовательность a No.

662
ATgt 350
ACgt 119
GAgt 93
GGgt 169
TAgt 125
TGgt 455
TTgt 96
TCgt 30
30
6 9750
CTgt 32
CCgt 21

Для дальнейшего изучения того, насколько редкие последовательности распознавания 5′-сплайсинга распознаются P.falciparum , мы также исследовали роль экзонной последовательности в эффективности сплайсинга. Неожиданно мутация стороны экзона 5′-сайта сплайсинга с нативного CAgt на более распространенный AGgt или чрезвычайно редкий GCgt () оба привели к значительному увеличению активности люциферазы (столбцы 6 и 7). Таким образом, основным фактором, определяющим предпочтение сайта сплайсинга для этого интрона, является не непосредственно предшествующий динуклеотид экзона, а, вероятно, другие особенности фланкирующей последовательности экзона или интрона.Эти данные также предполагают, что последовательности экзона, непосредственно предшествующие интрону, могут влиять на эффективность сплайсинга или иным образом влиять на уровни белка. Все 16 динуклеотидных комбинаций встречаются, по крайней мере, изредка до интронов P. falciparum (). Возможность того, что они могут играть роль в регуляции экспрессии, интригует.

У человека и Saccharomyces cerevisiae (5) пятая позиция интрона является высококонсервативной G. Напротив, A, G и T одинаково распространены в этой позиции у P.falciparum (), несмотря на то, что остатки мяРНК U1 и U6, предположительно взаимодействующие с этим положением (25, 40), не изменяются между S. cerevisiae и P. falciparum (5). Было показано, что мутация G5 в S. cerevisiae снижает эффективность сплайсинга (10) и является второй ведущей причиной активации новых аберрантных 5′-сайтов сплайсинга при генетических заболеваниях человека, включая бета-талассемию, нейроакантоцитозный синдром МакЛеода и Мышечная дистрофия Дюшенна (1, 3, 7, 46).Чтобы проверить, влияет ли пятый нуклеотид также на активность сплайсинга в P. falciparum , мы мутировали этот остаток с G (нативный остаток в первом интроне ß-тубулина) на A или T. Оба являются общими в этом положении в P. .falciparum и гораздо реже встречаются у человека () или S. cerevisiae (39). Эти мутации были сделаны в конструкции плазмиды β-тубулина, в которой возможные альтернативные 5′-сайты сплайсинга были мутированы, чтобы гарантировать использование нативного 5′-сайта сплайсинга.Неожиданно конструкции с заменой A имели сплайсинговую активность, сравнимую с таковой у нативной конструкции G, в то время как замена T приводила к увеличению (). Следовательно, P. falciparum относительно толерантен к заменам A или T в этом месте, несмотря на тот факт, что остатки U1 и U6, которые, как предполагается, будут взаимодействовать с этим нуклеотидом, должны предпочтительно пара оснований с G в положении 5 (5).

P. falciparum Идентификация точки ветвления и согласованный мотив сайта ветвления.

На первом этапе сплайсинга пре-мРНК сборка сплайсосом включает спаривание оснований между последовательностью в U2 мяРНК и точкой ветвления (4, 53). У большинства эукариот точка ветвления обычно расположена около 5′-конца полипиримидинового тракта и пар оснований с 6-нуклеотидным мотивом в мяРНК U2 (4, 53). Например, интронов S. cerevisiae содержат по одной точке ветвления на расстоянии от 10 до 155 нуклеотидов перед 3′-сайтом сплайсинга. Эта точка ветвления (подчеркнутый A) расположена внутри высококонсервативной последовательности UACUAAC и пар оснований с 8-нуклеотидной последовательностью мяРНК U2 (43).Точка ветвления у млекопитающих находится в менее консервативной последовательности YURAY, обычно на 18–37 нуклеотидов выше 3′-сайта сплайсинга (39, 53). Несмотря на то, что последовательность мяРНК U2 P. falciparum идентична последовательности мяРНК S. cerevisiae и U2 человека в области взаимодействия точки ветвления (5), менее 10% интронов P. falciparum имеют очевидная консенсусная последовательность точки ветвления, аналогичная таковой у S. cerevisiae или человека (39). Поэтому экспериментально определены точки ветвления для четырех P.falciparum интронов.

Во время сплайсинга две последовательные переэтерификации производят лариат РНК. Лариаты образуются из пре-мРНК в результате нуклеофильной атаки выпуклого A в точке ветвления на 5′-донорском сайте сплайсинга. Это создает связь 2′-5 ‘, а не типичную связь 3′-5’, образуя кольцевую РНК с коротким линейным хвостом (53). РНК-лариаты недолговечны, но их можно обнаружить при низкой концентрации в общей РНК (44). Используя вложенные праймеры в дивергентной ориентации, можно получить продукты ОТ-ПЦР, которые пересекают точку ветвления ().Мы сосредоточились на генах с умеренной или высокой степенью экспрессии, чтобы увеличить вероятность обнаружения интронных лариатов. Выбор интрона в каждом гене определялся размером и последовательностью интрона. Были получены продукты ОТ-ПЦР для четырех интронов P. falciparum . Их клонировали и секвенировали, и точку ветвления идентифицировали путем сравнения с последовательностью геномной ДНК. Всего было выявлено 18 филиалов (). Неожиданно было обнаружено несколько точек ветвления для всех четырех интронов, и были обнаружены точки ветвления A и U, хотя точки ветвления A преобладали (14 из 18).В качестве контроля анализировали точки ветвления интрона человеческого β-глобина и интрона S. cerevisiae рибосомного белка. Для обоих все клоны имели одну и ту же точку ветвления, расположенную в точке A (данные не показаны). Этот подход, то есть ПЦР-амплификация через точку ветвления, также недавно был использован для идентификации точек ветвления для транс -сплайсированных РНК Trypanosoma brucei . Здесь также было обнаружено несколько точек ветвления на интрон (27). Большинство из них были точками ветвления A, но наблюдались точки ветвления C.Хотя они менее распространены, для сплайсинга cis сообщалось о точках ветвления U или C (12, 13, 16).

Резюме картирования точек ветвления в P. falciparum . (A) Схема подхода RT-PCR для картирования точек ветвления в четырех интронах P. falciparum . (B) Агарозный гель продуктов ПЦР, амплифицированных из РНК-лариатов рецептора активированного гомолога С-киназы (PfRACK, PF08_0019). + или — указывает, был ли образец РНК обработан РНКазой R перед обратной транскрипцией.М — ДНК-маркер; мР, мРНК; лар, лариат. Слева указаны размеры ДНК-маркеров в парах оснований. (C) Экспериментально определенные точки ветвления обозначены подчеркнутыми буквами. Указано расстояние каждой точки ветвления от 3′-сайта сплайсинга. (D) Сводная информация о точках разветвления.

У P. falciparum точки ветвления располагались от 23 до 57 нуклеотидов выше по течению от сайта 3′-сплайсинга (). Сравнение 18 точек ветвления выявило консенсусный мотив YWHWW (), который связан с консенсусной последовательностью человека (YURAY), но имеет большее смещение A / T и менее консервативен.Хотя сайт взаимодействия точки ветвления в мяРНК P. falciparum U2 является обычным (5), нам не удалось найти сильный потенциал спаривания оснований между U2 и наблюдаемыми точками ветвления P. falciparum .

Консенсусные последовательности, обнаруженные в интронах P. falciparum . (A) WebLogo для 18 точек ветвления, идентифицированных в четырех последовательностях P. falciparum . (B) Указаны консенсусные последовательности в сайтах сплайсинга 5 ‘и 3′ и последовательности точек ветвления. Пороговые значения для консенсусных последовательностей 5′- и 3’-сайтов сплайсинга были установлены на уровне 20%, а для точки ветвления — на 10%, поскольку последовательностей было меньше.Показано расстояние между 3 ‘местом соединения и точкой ветвления. W = A или T, R = A или G, D = T, или A, или G, Y = C или T, и H = C, или A, или T.

Спаривание оснований между мяРНК и последовательностями интронов является ключевым элементом для обеспечения сайты сплайсинга 5 ‘и 3’ сближаются, позволяя происходить переэтерификации. МяРНК образуют комплекс с белками, некоторые из которых также распознают и связывают интронные мотивы и другие белки, способствуя правильному позиционированию (14, 38, 45, 53). Эти элементы взаимодействуют и могут компенсировать мутацию или потерю другого.Мотивы консенсуса точки ветвления обычно сильнее у организмов с бедными интронами и слабее у организмов, богатых интронами (21). Точки ветвления у некоторых организмов, особенно у Caenorhabditis elegans , не обладают сильной комплементарностью U2. Вместо этого последние восемь нуклеотидов интронов C. elegans являются высококонсервативными, распознаются и связываются белковыми компонентами U2 snRNP, U2AF 35 и U2AF 65 (17, 55, 56), правильно позиционируя интрон и U2 мяРНК. С.cerevisiae не имеет ортолога U2AF 35 , а в его интронах отсутствует полипиримидиновый тракт, сайт связывания для его ортолога U2AF 65 . Однако жестко консервативная последовательность точки ветвления UACUAAC в S. cerevisiae (35, 54) обеспечивает более длинную область комплементарности с U2, чем это характерно для богатых интронами организмов. Поддержание точного позиционирования с учетом этих различий может способствовать сильной сохранности мотивов, чтобы обеспечить «якорь» для оборудования сращивания. Эти точки указывают на возможность компенсаторных изменений у P.falciparum , чтобы разместить мотив слабой точки ветвления.

Заключение.

Сравнительная геномика показала, что сила консенсусных последовательностей интронов варьируется в зависимости от эукариотических организмов (39). P. falciparum имеет одно из самых высоких содержаний AT (81%) среди всех секвенированных геномов (21) и, следовательно, представляет уникальную возможность исследовать адаптацию сплайсосом в глубоко ветвящемся эукариотическом организме с экстремальным смещением последовательности AT. За редким исключением (42, 50), интроны сплайсосом U2 характеризуются границами интронов 5’GU-AG3 ‘.Эти канонические особенности также сохраняются в P. falciparum , но с сильной консервацией мотивов границ интрона 5 ‘(WR / GUAADW) и 3′ (UAGRW). Соседний 3’-полипиримидиновый тракт имеет меньше нуклеотидов C в P. falciparum , чем в интронах человека (). Предсказанные традиционные мотивы точек ветвления редки у P. falciparum (42), и наши данные указывают на то, что консенсусный мотив точки ветвления является относительно слабым, со значительной толерантностью к заменам A / U.Примечательно, что было обнаружено несколько точек ветвления на интрон, причем некоторые из них располагались на остатках U вместо A. Точки ветвления, отличные от A, и множественные точки ветвления в интроне встречаются редко, но о них сообщалось ранее (16, 27), а использование альтернативных точек ветвления является фактором некоторых альтернативных сплайсинга (18, 19) и генетических заболеваний человека (2 , 31). Об альтернативном сплайсинге сообщалось у P. falciparum (32, 42), но неизвестно, являются ли альтернативные точки ветвления факторами в любом из этих случаев.

Секвенирование генома P. falciparum и анализ его транскриптома привели к появлению множества статей, оценивающих предсказанные интроны и консервативные последовательности. В этом исследовании мы перешли от прогнозов к экспериментальной оценке особенностей последовательности интронов, которые влияют на эффективность сплайсинга у P. falciparum . Наши данные подтверждают некоторые ожидаемые особенности сплайсинга эукариот и определяют неожиданную гибкость в мотиве точки ветвления и выборе места ветвления.

Идентификация точек ветвления и требования к последовательности для сплайсинга интронов у Plasmodium falciparum

Abstract

Сплайсинг мРНК — древний и эволюционно консервативный процесс у эукариотических организмов, но интрон-экзонная структура различается. Plasmodium falciparum имеет экстремальное смещение нуклеотидов AT (> 80%), что дает уникальную возможность исследовать, как эволюционные силы действуют на интронные структуры. В этом исследовании мы разработали анализ репортерного сплайсинга люциферазы in vivo и использовали его в сочетании с выделением лариата и секвенированием для характеристики требований 5′- и 3′-сплайсинга и экспериментального определения точки ветвления интрона в P.falciparum . Этот анализ показывает, что мРНК P. falciparum имеют канонические 5′- и 3′-сайты сплайсинга. Однако 5′-консенсусный мотив является слабо консервативным и допускает нуклеотидную замену, включая пятый нуклеотид в интроне, который, как правило, представляет собой нуклеотид G у большинства эукариот. Для сравнения, 3′-сайт сплайсинга имеет сильную консенсусную последовательность эукариот и прилегающий полипиримидиновый тракт. В четырех различных пре-мРНК P. falciparum были обнаружены множественные точки ветвления на интрон, причем некоторые из них располагались на U вместо типичного остатка A.Слабый консенсус по точкам ветвления был обнаружен среди 18 идентифицированных точек ветвления. Этот анализ показывает, что P. falciparum сохраняет многие консенсусные особенности эукариотических сайтов сплайсинга, несмотря на крайнее смещение кодонов, и обладает гибкостью в нуклеофильной атаке точки ветвления.

ВВЕДЕНИЕ

Интроны — это некодирующие последовательности, расположенные внутри транскриптов мРНК-предшественников (пре-мРНК), которые вырезаются перед экспортом в ядро ​​(39). Сплайсинг пре-мРНК требует мотивов последовательности в интроне и опосредуется рибонуклеопротеидным комплексом, называемым сплайсосомой (37, 53).В то время как фундаментальные механизмы сплайсинга законсервированы среди эукариот (4), мотивы распознавания сайтов сплайсинга короткие и часто слабо консервативны между организмами (20). Кроме того, большая часть программного обеспечения для прогнозирования опирается на модельные организмы, а экспериментальная характеристика сплайсинга интронов у глубоко ветвящихся эукариотических организмов была ограничена (50). Предполагается, что интроны присутствуют примерно в половине генов в геноме Plasmodium falciparum (11). Однако сообщалось о неточностях в предсказании интронов (26, 32, 42). P. falciparum имеет чрезвычайно богатый AT геном (11), который имеет значение как для эволюционной адаптации сплайсосомного аппарата, так и для точности предсказаний генной структуры.

Все сплайсосомные интроны содержат 5′-донорные и 3′-акцепторные сайты сплайсинга, обычно с динуклеотидами GU и AG на соответствующих концах интрона и точкой ветвления, расположенной внутри интрона. Интроны основного класса часто содержат полипиримидиновый тракт, прилегающий к 3′-сайту сплайсинга, который отсутствует в интронах второстепенного класса (29, 39).Во время сплайсинга нуклеотид точки ветвления инициирует нуклеофильную атаку на 5′-донорный сайт сплайсинга. Затем свободный конец вышележащего интрона инициирует вторую нуклеофильную атаку на 3′-акцепторный сайт сплайсинга, высвобождая интрон в виде лариата РНК и ковалентно объединяя два экзона (53). Изменение размера интрона в значительной степени связано с расстоянием от 5′-границы интрона до сайта ответвления. Подавляющее большинство интронов удаляется основной сплайсосомой, большой молекулярной машиной, которая содержит более 70 белков и пять комплексов рибонуклеопротеидов.Каждый комплекс содержит одну из пяти малых ядерных РНК (мяРНК), названных U1, U2, U4, U5 и U6, а также набор общих белков и дополнительных белков, специфичных для отдельных мяРНК (37, 53). Спаривание оснований мяРНК интрона и друг друга, а также взаимодействия белок-белок и белок-РНК факторов сплайсинга позиционируют сайты сплайсинга для сплайсинга (4, 53).

Недавно были идентифицированы пять мяРНК P. falciparum (5, 11, 49). Они похожи на таковые у позвоночных и, по-видимому, способны складываться в одно и то же общее строение (5).5 ‘и 3’ мотивы сайтов сплайсинга для интронов P. falciparum (динуклеотиды GU и AG) следуют общему эукариотическому паттерну (5, 42). Однако менее 10% интронов P. falciparum содержат последовательность, которая соответствует общепринятому консенсусу по консервативным точкам ветвления (20), а точка ветвления P. falciparum до сих пор экспериментально не определена. Поэтому представляет интерес экспериментальная проверка требований к последовательности интрона P. falciparum .

Интроны P. falciparum сравнительно короткие и чрезвычайно богаты АТ, в среднем 179 нуклеотидов (нуклеотидов) и 86,5% А + Т (11). Некоторые из них расположены в конце открытой рамки считывания, добавляя одну аминокислоту (22), или в нетранслируемой области (UTR) (33, 34). Они участвуют в контроле экспрессии гена var (8), и сообщалось о случаях специфической для стадии экспрессии, специфической для пола экспрессии и альтернативного сплайсинга (26, 32, 42). К ним относятся антиген 41-3 (23), поверхностный антиген MAEBL (41), аденилатциклаза с альтернативными AUG из-за паттернов сплайсинга (30), аспартилпротеаза с тремя вариантами (52), антиген SET (для которого сплайсинг регулируется полом в гаметоцитах) (33, 34) и соседних генах с двумя общими 5′-экзонами, которые сплайсированы с разными нижележащими экзонами (51).Недавние оценки альтернативного сплайсинга с помощью анализа RNA-Seq выявили множество дополнительных событий альтернативного сплайсинга в пре-мРНК P. falciparum (32, 42). Таким образом, сплайсинг является ключевым элементом экспрессии генов, который мало изучен у Plasmodium . В этом исследовании мы разработали in vivo анализ репортерного сплайсинга люциферазы и использовали его в сочетании с выделением лариат и секвенированием для характеристики требований 5 ‘и 3’ сплайсинга и экспериментального определения точки ветвления интрона.

МАТЕРИАЛЫ И МЕТОДЫ

Выделение лариата и секвенирование.

РНК выделяли из лизированных сапонином 3D7-инфицированных эритроцитов на смешанных стадиях с использованием TRIzol LS (Invitrogen) и хлороформа в соответствии с инструкциями производителя. РНК (100 нг) инкубировали с ДНКазой I, свободной от РНКазы Ambion, для удаления геномной ДНК. Перед обратной транскрипцией половину РНК обрабатывали 1 мкг РНКазы R в буфере, содержащем 20 мМ Трис-HCl (pH 8,2), 100 мМ KCl и 0,25 мМ MgCl 2 при 37 ° C в течение 60 минут для переваривания линейной РНК и обогащают РНК лариата.Другая половина ложно обрабатывалась только буфером. Для обратной транскрипции использовали обратную транскриптазу SuperScript III (Invitrogen) со смесью 50:50 случайных праймеров и олиго (dT) праймеров, следуя инструкциям производителя. кДНК и РНК лариатные продукты были амплифицированы для четырех различных генов P. falciparum (PF08_0019, PF14_0027, PF10_0155 и PFL0190w) с использованием праймеров для ПЦР, перечисленных в таблице S1 в дополнительном материале. ПЦР выполняли с использованием системы высокоточной ПЦР Expand (Roche PCR) в реакционном объеме 50 мкл, содержащем 1 × буфер для ПЦР с 1.5 мМ MgCl 2, 2 мкМ праймеров, 0,2 мМ дезоксинуклеозидтрифосфатов (dNTP) и 0,05 Ед / мкл полимеразы Taq . Для амплификации кДНК использовали тридцать циклов. Для амплификации лариата вложенные праймеры были сконструированы в дивергентной ориентации, чтобы продукт ПЦР пересекал точку ветвления. За первым циклом ПЦР с 25 циклами следовал второй цикл с 20 циклами, при этом продукт ПЦР очищали между циклами с использованием набора для очистки Qiagen PCR. Продукты ПЦР лариата экстрагировали из агарозных гелей, очищали с помощью набора для экстракции гелей QIAquick (Qiagen), клонировали в вектор T-easy (Promega) и трансфицировали в компетентные клетки Escherichia coli DH5.Плазмиду экстрагировали с помощью мини-набора плазмид (Qiagen) и подвергали секвенированию ДНК.

Конструирование слитых векторов pBtub-fLuc с вариациями интронов для мониторинга сплайсинга мРНК.

Для исследования требований к сплайсингу мРНК в P. falciparum был разработан вектор слияния (pBtubi-fLuc), содержащий последовательность первого интрона и фланкирующего экзона β-тубулина (PF10_0084), слитых с люциферазой светлячка в основной цепи вектора pPf86 (любезно любезно предоставлено Дайаном Виртом и Кевином Милителло) (28).N-концевой слитый вектор β-тубулина (pBtub-fLuc), в котором отсутствует интронная последовательность β-тубулина, был сконструирован в качестве контроля для экспериментов по сплайсингу РНК, и из этого вектора были созданы клоны с вариациями интрона. Конструирование вектора слияния pBtub-fLuc и вариаций интрона подробно описано в разделе «Дополнительные экспериментальные процедуры» в дополнительном материале. В таблице S2 дополнительных материалов перечислены все плазмиды, созданные во время этого исследования, а также последовательность β-тубулина в каждой плазмиде.Плазмиды проверяли секвенированием перед трансфекцией. Типичная плазмидная карта для вектора pBtubi-fLuc показана вместе с последовательностью нативного интрона β-тубулина и фланкирующей последовательностью экзона, используемой при конструировании вектора.

Анализ сплайсинга пре-мРНК в P. falciparum с использованием конструкции слияния β-тубулин-люцифераза. (А) Репортерная конструкция pBtubi1-fluc. Первый интрон гена β-тубулина P. falciparum с окружающими экзонными областями был слит в рамке 5 ‘с репортерным геном люциферазы светлячка.(B) Последовательность β-тубулина, включенного в конструкцию pBtub-fluc. Прописные буквы — последовательность экзона; строчная, интронная последовательность. Возможные альтернативные нуклеотиды 5′-GT и 3’-AG в рамке считывания подчеркнуты. (C к E) Относительное количество активности люциферазы светлячков нормализовали котрансфекцией плазмидой, экспрессирующей люциферазу Renilla . «Без интрона» — это контрольная плазмида слияния, из которой удален интрон β-тубулина. Плазмидные конструкции, помеченные «5mod», представляют собой конструкции, в которых три альтернативных 5′-остатка GT в рамке считывания были заменены нуклеотидами CT.

Культивирование P. falciparum , трансфекция и анализ люциферазы.

D10 паразитов использовали для всех экспериментов по трансфекции и культивировали в стандартных условиях (47) в среде RPMI 1640 с добавлением 0,5% (вес / объем) Albumax II (Invitrogen, Carlsbad, CA) и эритроцитами человека при гематокрите 2%. . Культуры синхронизировали с использованием 5% сорбита (24). Шизонты были выделены с помощью очистки с помощью сортировки магнитно-активированных клеток (MACS) (48) и позволили повторно проникнуть в новые эритроциты в течение 12 часов перед трансфекцией, что привело к появлению эритроцитов, инфицированных на кольцевой стадии с высоким уровнем паразитемии, во время трансфекции.Инфицированные эритроциты подвергали электропорации с использованием Bio-Rad Gene Pulser Xcell с 75 мкг экспериментальной плазмиды и 50 мкг контрольной плазмиды Renilla (любезно предоставленной Дайаном Виртом и Кевином Милителло). Электропорацию проводили в кюветах диаметром 0,2 см с использованием низкого напряжения (0,31 кВ) и высокой емкости (950 мкФ) (9). Трансфектанты поддерживали на среде без фенолового красного и собирали через 16 ч центрифугированием. Лизис паразитов и анализ люциферазы выполняли в соответствии с протоколом производителя с системой анализа двойной люциферазы-репортера (Promega) с использованием однотрубного люминометра Sirius (Berthold).

Секвенирование мРНК конструкции репортера β-тубулина.

РНК собирали экстракцией TRIzol LS (Invitrogen) -1-бром-3-хлорпропан из D10-инфицированных эритроцитов, временно трансфицированных плазмидой pβtubi1-fLuc, содержащей интрон дикого типа. Загрязнение плазмидной ДНК этой РНК было уменьшено обработкой набором Turbo DNA-free (Ambion) и коктейлем рестрикционных ферментов, включая AluI, MnlI и NlaIII (NEB), а также фенол-хлороформом и 1-бром-3- хлорпропановые экстракты.ПЦР с обратной транскрипцией (ОТ-ПЦР) выполняли с использованием реагентов обратной транскрипции TaqMan (Applied Biosystems) и системы высокоточной ПЦР Expand (Roche). ОТ-ПЦР выполняли с использованием прямого праймера в экзоне 1 β-тубулина (5 ‘CATATTCAAGCTGGCCAATGTGGAAATC) и обратного праймера в люциферазе светлячка (5’ AGTTGCTCTCCAGCGGTTCCATC). Продукт выделяли из агарозного геля с использованием геля Wizard SV и системы очистки ПЦР (Promega), а затем клонировали в pGEM-T Easy (Promega). Плазмиды получали с помощью набора FastPlasmid miniprep (5 PRIME) и секвенировали с использованием праймеров SP6 и T7.

Анализ последовательностей

P. falciparum и человеческих интронов.

Последовательности, окружающие 5′-донорные и 3′-акцепторные сайты сплайсинга, были получены с использованием программы для сборки сплайсированных выравниваний (PASA) (15) для сборки тегов экспрессируемой последовательности P. falciparum (EST) в последовательность генома 3D7. EST были получены из двух источников: 14 362 бесполых EST P. falciparum и 5 814 EST гаметоцитов P. falciparum были получены из GenBank, а 7 683 P.falciparum 3D7 EST были получены в лаборатории Гарднера на смешанных бесполых стадиях (З. Ханг и М. Гарднер, неопубликованные данные). Выравнивания PASA дали 3641 P. falciparum EST-подтвержденных последовательностей интронов и последовательностей экзонов, фланкирующих каждый интрон. Данные для 20 000 интронов были получены из набора из 1533 генов человека в базе данных NCBI RefSeq (36). Последовательности длиной в двадцать нуклеотидов, окружающие сайты сплайсинга, были использованы для создания логотипов последовательностей с помощью WebLog 3 (http: // weblogo.threeplusone.com/) (6) с параметрами по умолчанию, за исключением того, что использовалась классическая цветовая схема, а единицы были нанесены на график как «вероятность».

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Биоинформатический анализ

интронов P. falciparum .

Аннотации генома P. falciparum основаны на смеси подтвержденных последовательностью и предсказанных расчетами экзон-интронных структур (11). Поскольку некоторые прогнозы могут быть неточными, PASA использовался для выравнивания и сборки 23 817 P.falciparum EST против генома 3D7, чтобы получить проверенный набор из интронов P. falciparum для анализа. В общей сложности был идентифицирован 3641 EST-подтвержденный интрон (), а также последовательности экзонов, фланкирующие сайты сплайсинга 5 ‘и 3’. Точное соответствие распределений размеров нашего набора данных интронов по сравнению с исходной аннотацией генома (11) указывает на то, что это репрезентативный образец из интронов P. falciparum (). Длина интрона варьировала от 38 нуклеотидов до почти 4 т.п.н., но средний размер невелик: только 20 интронов превышают 1 т.п.н.Анализ позиций, фланкирующих каждое соединение, показывает хорошее совпадение с эукариотическим консенсусом для сайтов сплайсинга. Каноническая 3′-последовательность 5’GU-AG 3 ‘была почти на 100% консервативной, и непосредственно фланкирующие последовательности экзона имели консенсусную последовательность WR для 5′ и RW для 3’-сайта сплайсинга (). В среднем 87% из остатков интрона P. falciparum — это А или Т (11). Это смещение также обычно наблюдается в последовательностях интронов, непосредственно примыкающих к сайтам сплайсинга GT-AG, за исключением того, что положение пятого нуклеотида в 5′-сайте сплайсинга представляет собой равное распределение нуклеотидов A, T или G ().У других организмов нуклеотид G чаще встречается в этой позиции (), поэтому это различие было исследовано в анализе сплайсинга РНК, описанном ниже. Многие интроны сплайсосом U2 имеют полипиримидиновый тракт, непосредственно примыкающий к 3′-сайту сплайсинга, который распознается фактором сплайсинга U2AF 65 . Взаимодействия этого белка с U2AF 35 , который распознает 3′-сайт сплайсинга, и белки, участвующие в распознавании точки ветвления, являются важными элементами для позиционирования компонентов, необходимых для сплайсинга (29). P. falciparum имеет предполагаемые ортологи для U2AF 35 (PF11_0200) и U2AF 65 (PF14_0656), а также других ключевых факторов сплайсинга, и, как и ожидалось, большинство интронов содержат полипиримидиновый тракт, прилегающий к 3′-сплайсингу. консенсусная последовательность сайта (YAGRW). Однако полипиримидиновый тракт P. falciparum содержит меньше нуклеотидов С, чем интроны человека, и имеет больше нуклеотидов А ().

Таблица 1.

0003

Характеристика интрона Значение от:


Аннотированная последовательность (11) Сборки PASA
No. 7,406 3,641
Наибольший (nt) 3,040 3,998
Наименьший (nt) 3 38
9

9

700070006504

Таблица 2.

Последовательности сращивания

50

50

50

9506

9506 Wary a

Место сращивания и характеристика Значение в положении nt (относительно стыка сращивания):


−3 −2 90 −3 1 2 3
5 ′
% от основания:
G 8.9 53,7 100 a 2,8
A 64,2 26,7 0 0007 900 000

19,4 14,4 0 99,7 10,2
C 7,2 5,1 0
П.falciparum W R g u a
Eukaryote A G g 900

% от основания:
G <1 99,5 36 12,3
A 12.1 96,8 39,6 34,7
U 68 15,7 41,7 5,5 10,8
Консенсус
P. falciparum y a g R 00 g G U

Сравнение 5 ‘и 3’ сайтов сращивания WebLogos для людей и P.falciparum . Высота каждой буквы указывает силу предпочтения этого нуклеотида в каждой позиции.

Влияние мутаций 5 ‘и 3’ сайтов сплайсинга на эффективность сплайсинга мРНК у

P. falciparum .

Чтобы исследовать потребности в сплайсинге мРНК в P. falciparum , мы разработали анализ временной трансфекции, в котором экспрессия люциферазы светлячков зависит от правильного сплайсинга интронов (). P. falciparum β-тубулин имеет два коротких интрона длиной 350 и 168 нуклеотидов (11).Первый интрон гена β-тубулина P. falciparum с короткими фланкирующими участками экзона был слит в рамке 5 ‘с репортерным геном люциферазы светлячка (). Интрон содержит стоп-кодоны во всех трех рамках считывания, чтобы остановить трансляцию, если сплайсинг не происходит. Репортерную плазмиду котрансфицировали плазмидой, экспрессирующей люциферазу Renilla , в эритроцитов, инфицированных P. falciparum , для нормализации активности между экспериментами. Конструкция светлячка, содержащая только последовательности экзона β-тубулина без интрона, была включена в качестве положительного контроля.Конструкции, содержащие интроны, и конструкции без интронов производили сходные количества люциферазной активности (и D, первые два столбца). Достоверность анализа сплайсинга проверяли с помощью ОТ-ПЦР и секвенирования сплайсированного продукта слияния мРНК, который, как было обнаружено, был сплайсирован на ожидаемых участках нативного гена β-тубулина (данные не показаны).

Чтобы исследовать требования к последовательностям для эффективного распознавания сайтов сплайсинга, был приготовлен ряд плазмид, содержащих модифицированные последовательности β-тубулина, и протестирован в анализе сплайсинга.В 3′-сайте сплайсинга нативная последовательность agAG была мутирована на tcAG и acAG (последовательности интронов указаны в нижнем регистре). Оба изменения полностью исключают активность люциферазы светлячков (). Для сравнения, мутация 5′-сайта сплайсинга от CAgt к CAct значительно снижала, но не отменяла люциферазную активность (, столбец 3), возможно, из-за присутствия потенциальных альтернативных 5′-сайтов сплайсинга как перед, так и после границы экзон-интрон. (подчеркнутые ГТ).

Первый интрон в P.falciparum β-тубулин имеет редкий 5′-акцепторный сайт сплайсинга, CAgt (). Одним из потенциальных альтернативных сайтов сплайсинга в рамке считывания может быть гораздо более распространенный 5′-акцепторный сайт сплайсинга AAgt (). Чтобы исследовать особенности последовательности, которые влияют на распознавание 5′-сплайсинга в P. falciparum , мы мутировали AAgt и два других потенциальных альтернативных сайта сплайсинга с GT на CT (подчеркнутые нуклеотиды), сохранив при этом нативный 5′-сайт сплайсинга (конструкция 5mod CAgt) . Эта комбинация мутаций только частично снижает активность люциферазы (, столбец 4), указывая на то, что нативный сайт является предпочтительным сайтом узнавания в репортерной конструкции, несмотря на то, что он является редким типом.Мутация нативного 5′-сайта сплайсинга в дополнение к возможным альтернативным сайтам снижает активность люциферазы почти до фоновых уровней (столбец 5). Интересно, что существуют также альтернативные последовательности AG в рамке считывания, расположенные ниже 3′-сайта сплайсинга (подчеркнутые AG). Они, по-видимому, не способны компенсировать потерю 3′-сайта сплайсинга, вероятно потому, что они не соседствуют с полипиримидиновым трактом () и поэтому не распознаются U2AF 65 . Взятые вместе, эти данные показывают, что P.falciparum имеет традиционные мотивы сайтов сплайсинга 5’GU-AG3 ‘.

Таблица 3.

5 ‘Частоты сплайсинга

0007

9007

70007

4

975 35

Последовательность a No.

662
ATgt 350
ACgt 119
GAgt 93
GGgt 169
TAgt 125
TGgt 455
TTgt 96
TCgt 30
30
6 9750
CTgt 32
CCgt 21

Для дальнейшего изучения того, насколько редкие последовательности распознавания 5′-сплайсинга распознаются P.falciparum , мы также исследовали роль экзонной последовательности в эффективности сплайсинга. Неожиданно мутация стороны экзона 5′-сайта сплайсинга с нативного CAgt на более распространенный AGgt или чрезвычайно редкий GCgt () оба привели к значительному увеличению активности люциферазы (столбцы 6 и 7). Таким образом, основным фактором, определяющим предпочтение сайта сплайсинга для этого интрона, является не непосредственно предшествующий динуклеотид экзона, а, вероятно, другие особенности фланкирующей последовательности экзона или интрона.Эти данные также предполагают, что последовательности экзона, непосредственно предшествующие интрону, могут влиять на эффективность сплайсинга или иным образом влиять на уровни белка. Все 16 динуклеотидных комбинаций встречаются, по крайней мере, изредка до интронов P. falciparum (). Возможность того, что они могут играть роль в регуляции экспрессии, интригует.

У человека и Saccharomyces cerevisiae (5) пятая позиция интрона является высококонсервативной G. Напротив, A, G и T одинаково распространены в этой позиции у P.falciparum (), несмотря на то, что остатки мяРНК U1 и U6, предположительно взаимодействующие с этим положением (25, 40), не изменяются между S. cerevisiae и P. falciparum (5). Было показано, что мутация G5 в S. cerevisiae снижает эффективность сплайсинга (10) и является второй ведущей причиной активации новых аберрантных 5′-сайтов сплайсинга при генетических заболеваниях человека, включая бета-талассемию, нейроакантоцитозный синдром МакЛеода и Мышечная дистрофия Дюшенна (1, 3, 7, 46).Чтобы проверить, влияет ли пятый нуклеотид также на активность сплайсинга в P. falciparum , мы мутировали этот остаток с G (нативный остаток в первом интроне ß-тубулина) на A или T. Оба являются общими в этом положении в P. .falciparum и гораздо реже встречаются у человека () или S. cerevisiae (39). Эти мутации были сделаны в конструкции плазмиды β-тубулина, в которой возможные альтернативные 5′-сайты сплайсинга были мутированы, чтобы гарантировать использование нативного 5′-сайта сплайсинга.Неожиданно конструкции с заменой A имели сплайсинговую активность, сравнимую с таковой у нативной конструкции G, в то время как замена T приводила к увеличению (). Следовательно, P. falciparum относительно толерантен к заменам A или T в этом месте, несмотря на тот факт, что остатки U1 и U6, которые, как предполагается, будут взаимодействовать с этим нуклеотидом, должны предпочтительно пара оснований с G в положении 5 (5).

P. falciparum Идентификация точки ветвления и согласованный мотив сайта ветвления.

На первом этапе сплайсинга пре-мРНК сборка сплайсосом включает спаривание оснований между последовательностью в U2 мяРНК и точкой ветвления (4, 53). У большинства эукариот точка ветвления обычно расположена около 5′-конца полипиримидинового тракта и пар оснований с 6-нуклеотидным мотивом в мяРНК U2 (4, 53). Например, интронов S. cerevisiae содержат по одной точке ветвления на расстоянии от 10 до 155 нуклеотидов перед 3′-сайтом сплайсинга. Эта точка ветвления (подчеркнутый A) расположена внутри высококонсервативной последовательности UACUAAC и пар оснований с 8-нуклеотидной последовательностью мяРНК U2 (43).Точка ветвления у млекопитающих находится в менее консервативной последовательности YURAY, обычно на 18–37 нуклеотидов выше 3′-сайта сплайсинга (39, 53). Несмотря на то, что последовательность мяРНК U2 P. falciparum идентична последовательности мяРНК S. cerevisiae и U2 человека в области взаимодействия точки ветвления (5), менее 10% интронов P. falciparum имеют очевидная консенсусная последовательность точки ветвления, аналогичная таковой у S. cerevisiae или человека (39). Поэтому экспериментально определены точки ветвления для четырех P.falciparum интронов.

Во время сплайсинга две последовательные переэтерификации производят лариат РНК. Лариаты образуются из пре-мРНК в результате нуклеофильной атаки выпуклого A в точке ветвления на 5′-донорском сайте сплайсинга. Это создает связь 2′-5 ‘, а не типичную связь 3′-5’, образуя кольцевую РНК с коротким линейным хвостом (53). РНК-лариаты недолговечны, но их можно обнаружить при низкой концентрации в общей РНК (44). Используя вложенные праймеры в дивергентной ориентации, можно получить продукты ОТ-ПЦР, которые пересекают точку ветвления ().Мы сосредоточились на генах с умеренной или высокой степенью экспрессии, чтобы увеличить вероятность обнаружения интронных лариатов. Выбор интрона в каждом гене определялся размером и последовательностью интрона. Были получены продукты ОТ-ПЦР для четырех интронов P. falciparum . Их клонировали и секвенировали, и точку ветвления идентифицировали путем сравнения с последовательностью геномной ДНК. Всего было выявлено 18 филиалов (). Неожиданно было обнаружено несколько точек ветвления для всех четырех интронов, и были обнаружены точки ветвления A и U, хотя точки ветвления A преобладали (14 из 18).В качестве контроля анализировали точки ветвления интрона человеческого β-глобина и интрона S. cerevisiae рибосомного белка. Для обоих все клоны имели одну и ту же точку ветвления, расположенную в точке A (данные не показаны). Этот подход, то есть ПЦР-амплификация через точку ветвления, также недавно был использован для идентификации точек ветвления для транс -сплайсированных РНК Trypanosoma brucei . Здесь также было обнаружено несколько точек ветвления на интрон (27). Большинство из них были точками ветвления A, но наблюдались точки ветвления C.Хотя они менее распространены, для сплайсинга cis сообщалось о точках ветвления U или C (12, 13, 16).

Резюме картирования точек ветвления в P. falciparum . (A) Схема подхода RT-PCR для картирования точек ветвления в четырех интронах P. falciparum . (B) Агарозный гель продуктов ПЦР, амплифицированных из РНК-лариатов рецептора активированного гомолога С-киназы (PfRACK, PF08_0019). + или — указывает, был ли образец РНК обработан РНКазой R перед обратной транскрипцией.М — ДНК-маркер; мР, мРНК; лар, лариат. Слева указаны размеры ДНК-маркеров в парах оснований. (C) Экспериментально определенные точки ветвления обозначены подчеркнутыми буквами. Указано расстояние каждой точки ветвления от 3′-сайта сплайсинга. (D) Сводная информация о точках разветвления.

У P. falciparum точки ветвления располагались от 23 до 57 нуклеотидов выше по течению от сайта 3′-сплайсинга (). Сравнение 18 точек ветвления выявило консенсусный мотив YWHWW (), который связан с консенсусной последовательностью человека (YURAY), но имеет большее смещение A / T и менее консервативен.Хотя сайт взаимодействия точки ветвления в мяРНК P. falciparum U2 является обычным (5), нам не удалось найти сильный потенциал спаривания оснований между U2 и наблюдаемыми точками ветвления P. falciparum .

Консенсусные последовательности, обнаруженные в интронах P. falciparum . (A) WebLogo для 18 точек ветвления, идентифицированных в четырех последовательностях P. falciparum . (B) Указаны консенсусные последовательности в сайтах сплайсинга 5 ‘и 3′ и последовательности точек ветвления. Пороговые значения для консенсусных последовательностей 5′- и 3’-сайтов сплайсинга были установлены на уровне 20%, а для точки ветвления — на 10%, поскольку последовательностей было меньше.Показано расстояние между 3 ‘местом соединения и точкой ветвления. W = A или T, R = A или G, D = T, или A, или G, Y = C или T, и H = C, или A, или T.

Спаривание оснований между мяРНК и последовательностями интронов является ключевым элементом для обеспечения сайты сплайсинга 5 ‘и 3’ сближаются, позволяя происходить переэтерификации. МяРНК образуют комплекс с белками, некоторые из которых также распознают и связывают интронные мотивы и другие белки, способствуя правильному позиционированию (14, 38, 45, 53). Эти элементы взаимодействуют и могут компенсировать мутацию или потерю другого.Мотивы консенсуса точки ветвления обычно сильнее у организмов с бедными интронами и слабее у организмов, богатых интронами (21). Точки ветвления у некоторых организмов, особенно у Caenorhabditis elegans , не обладают сильной комплементарностью U2. Вместо этого последние восемь нуклеотидов интронов C. elegans являются высококонсервативными, распознаются и связываются белковыми компонентами U2 snRNP, U2AF 35 и U2AF 65 (17, 55, 56), правильно позиционируя интрон и U2 мяРНК. С.cerevisiae не имеет ортолога U2AF 35 , а в его интронах отсутствует полипиримидиновый тракт, сайт связывания для его ортолога U2AF 65 . Однако жестко консервативная последовательность точки ветвления UACUAAC в S. cerevisiae (35, 54) обеспечивает более длинную область комплементарности с U2, чем это характерно для богатых интронами организмов. Поддержание точного позиционирования с учетом этих различий может способствовать сильной сохранности мотивов, чтобы обеспечить «якорь» для оборудования сращивания. Эти точки указывают на возможность компенсаторных изменений у P.falciparum , чтобы разместить мотив слабой точки ветвления.

Заключение.

Сравнительная геномика показала, что сила консенсусных последовательностей интронов варьируется в зависимости от эукариотических организмов (39). P. falciparum имеет одно из самых высоких содержаний AT (81%) среди всех секвенированных геномов (21) и, следовательно, представляет уникальную возможность исследовать адаптацию сплайсосом в глубоко ветвящемся эукариотическом организме с экстремальным смещением последовательности AT. За редким исключением (42, 50), интроны сплайсосом U2 характеризуются границами интронов 5’GU-AG3 ‘.Эти канонические особенности также сохраняются в P. falciparum , но с сильной консервацией мотивов границ интрона 5 ‘(WR / GUAADW) и 3′ (UAGRW). Соседний 3’-полипиримидиновый тракт имеет меньше нуклеотидов C в P. falciparum , чем в интронах человека (). Предсказанные традиционные мотивы точек ветвления редки у P. falciparum (42), и наши данные указывают на то, что консенсусный мотив точки ветвления является относительно слабым, со значительной толерантностью к заменам A / U.Примечательно, что было обнаружено несколько точек ветвления на интрон, причем некоторые из них располагались на остатках U вместо A. Точки ветвления, отличные от A, и множественные точки ветвления в интроне встречаются редко, но о них сообщалось ранее (16, 27), а использование альтернативных точек ветвления является фактором некоторых альтернативных сплайсинга (18, 19) и генетических заболеваний человека (2 , 31). Об альтернативном сплайсинге сообщалось у P. falciparum (32, 42), но неизвестно, являются ли альтернативные точки ветвления факторами в любом из этих случаев.

Секвенирование генома P. falciparum и анализ его транскриптома привели к появлению множества статей, оценивающих предсказанные интроны и консервативные последовательности. В этом исследовании мы перешли от прогнозов к экспериментальной оценке особенностей последовательности интронов, которые влияют на эффективность сплайсинга у P. falciparum . Наши данные подтверждают некоторые ожидаемые особенности сплайсинга эукариот и определяют неожиданную гибкость в мотиве точки ветвления и выборе места ветвления.

Оценка инструментов прогнозирования точки ветвления для прогнозирования физиологических точек ветвления и их изменения по вариантам | BMC Genomics

Биоинформатическое обнаружение точек ветвления между физиологическими и альтернативными акцепторными сайтами сплайсинга

В этом исследовании использовались два набора данных 3’ss, 3’ss описаны в наборе данных Ensembl и альтернативные 3’ss с данными их экспрессии из Анализ РНК-seq (таблица 2). Время работы показало, что BPP является одним из наиболее быстрых инструментов, а Branchpointer — одним из более медленных инструментов (дополнительный файл 1: рисунок S3).

Таблица 2 Сводка наборов данных, используемых для сравнения инструментов прогнозирования

Сначала мы извлекли 264 787 Ensembl 3’ss из данных Ensembl. Добавив к этим 3’ss, 114 603 295 случайных AG использовались в качестве контрольных данных (подробности см. В разделе «Методы»). Таким образом, мы собрали 114 868 082 3 ш. Затем был проведен анализ кривой ROC для SVM-BPfinder, BPP, LaBranchoR и RNABPS на наборе Ensembl 3’ss, как показано на рис. 2а. В таблице 3 показаны уровни точности, чувствительности, специфичности, положительной прогностической ценности (PPV) и отрицательной прогностической ценности (NPV), полученные из этих анализов кривой ROC.Что касается площади под кривыми (AUC), оценка, предоставленная BPP, показала наилучшие характеристики (AUC = 0,818). Однако Branchpointer показал самые высокие показатели с точностью 99,49% и PPV 30,06%. Таким образом, Branchpointer был самым строгим из биоинформатических инструментов для обнаружения предполагаемых БП до Ensembl 3’ss. Действительно, SVM-BPfinder, BPP, LaBranchoR и RNABPS обнаруживали предполагаемые BP для каждого Ensembl 3’ss и случайных AG. Для этих 4 инструментов наилучшая точность отличия Ensembl 3’ss от случайных AG была достигнута с помощью BPP (75.23%). В целом, 74 539 834 3 сс имели АД, спрогнозированную по крайней мере одним инструментом. Максимальное перекрытие прогнозируемых значений АД наблюдалось между LaBranchoR и RNABPS (28,63%; 21 337 483/74 539 834 3’ss) (дополнительный файл 1: Рисунок S4). Процент неудач с BP, предсказанных пятью инструментами, составил 0,15% (111 937/74 539 834). Семьдесят пять процентов (83 892/111 937) из этих трех составляли Ensembl 3 (дополнительный файл 1: Рисунок S5).

Рис. 2

ROC-кривые оценок биоинформатики. Для каждого возможного порога оценки были нанесены на график чувствительность и специфичность. а . Обнаружение точек ветвления из набора сайтов сращивания акцепторов Ensembl ( n = 114 868 082) оценок BPP, SVM-BPfinder, LaBranchoR и RNABPS. б . Обнаружение точек ветвления из альтернативных 3’ss с помощью SVM-BPfinder, BPP и LaBranchoR ( n = 103 972). с . Дельта-баллы HSF, SVM-BPfinder, BPP, Branchpointer, LaBranchoR и RNABPS для вариантов класса ( n = 120)

Таблица 3 Производительность инструментов, полученных из таблицы непредвиденных обстоятельств с набором данных Ensembl ( n = 114 868 082)

Среди альтернативных соединений анализа всего транскриптома было выявлено 51 986 альтернативных 3-х (подробности см. В разделе «Методы» и Дополнительный файл 1: Рисунок S6), к которому мы добавили такое же количество контрольных 3’ss.В целом, у нас было 2 подмножества из 51 986 (103 972) акцепторных сайтов для полных транскриптомных данных (дополнительный файл 2: таблица S1). Анализ SpliceLauncher показал, что 99,5% соединений сплайсинга (51 703/51 988, данные не показаны) не имели значительной разницы в экспрессии в разных условиях культивирования клеток и в разных вариантах. Относительное выражение альтернативной тройки, по-видимому, подчиняется нормальному логарифмическому распределению (Shapiro-Wilk p -value = 0,09 и дополнительный файл 1: рисунок S7).Исходя из этих данных, Branchpointer превзошел все протестированные инструменты для обнаружения предполагаемых BP (Таблица 4). Действительно, AUC трех инструментов, SVM-BPfinder, BPP, LaBranchoR и RNABPS, не превышала 0,612 (RNABPS) (рис. 2b). Branchpointer показал лучшую точность 65,8% на альтернативных сайтах сращивания. Кроме того, этот инструмент продемонстрировал аналогичную специфичность с данными Ensembl и RNA-seq, 99,6 и 99,5% соответственно. Однако в целом по данным транскриптома чувствительность снизилась более чем на 60% (с 95.От 5 до 32,1%) (Таблица 3 и Таблица 4). Альтернативная тройка и контрольная тройка имели АД, предсказанные по крайней мере одним из инструментов в 91,2% (94 806/103 972). Максимальное перекрытие наблюдалось между четырьмя инструментами SVM-BPfinder, BPP, LaBranchoR и RNABPS (7227/94 806 3’ss). Более 95% 3’s с BP, предсказанным только Branchpointer, были альтернативными сайтами сращивания (дополнительный файл 1: рисунок S8). При парном сравнении два инструмента LaBranchoR и RNABPS показали максимальное перекрытие 34,57% (32 777/94 806 3ss) с общими BP (дополнительный файл 1: рисунок S4).

Таблица 4 Производительность инструментов биоинформатики на альтернативных сайтах сплайсинга акцепторов ( n = 103,972)

Мы сравнили экспрессию альтернативных сайтов на основе данных RNA-seq с наличием и без присутствия предполагаемого BP, предсказанного биоинформатические инструменты (подробнее см. в разделе «Методы»). Этот анализ показал, что 3’ss с прогнозируемым АД были значительно более выраженными, чем 3’ss без прогнозируемого АД, независимо от инструмента биоинформатики (рис.3). Большая разница в экспрессии наблюдалась для Branchpointer. Среднее выражение было 34,00 и 1,35% для альтернативы 3’ss с АД, предсказанным с помощью Branchpointer, или нет, соответственно. В подгруппе 3’ss с прогнозируемым АД оценка Branchpointer не коррелировала с экспрессией этих сайтов (R 2 = 0,00001, p -значение = 0,24). Другие инструменты биоинформатики продемонстрировали слабую корреляцию между их оценкой и выражением (дополнительный файл 1: рисунок S9).Среди SVM-BPfinder, BPP, LaBranchoR и RNABPS наилучшая корреляция была получена с RNABPS (детерминантный коэффициент (R 2 ) = 0,0062, p -значение = 4,14 × 10 — 70 ).

Рис. 3

Экспрессия 3’ss в соответствии с наличием или отсутствием предсказанной точки ветвления с помощью инструментов биоинформатики из данных RNA-seq ( n = 51 986 3’ss). ***: p -значение (тест Стьюдента) <2e-16. В скобках указана средняя экспрессия между двумя группами

Биоинформатическое прогнозирование эффекта сплайсинга для вариантов в области точки ветвления

Последний набор данных представлял собой набор экспериментально охарактеризованных картированных потенциально сплайсогенных вариантов в областях BP (см. «Методы» раздел для деталей), n = 120 вариантов среди 86 интронов в 36 различных генах (Таблица 2 и Дополнительный файл 3: Таблица S2).Часть этой коллекции была получена из неопубликованных данных ( n = 62 варианта). Было обнаружено, что из 120 вариантов 38 (31,7%) вызывают изменения сплайсинга и поэтому считаются сплайсогенными, тогда как 82 (68,3%) не показывают изменений сплайсинга в наших экспериментальных условиях. Рис. 4 показывает перераспределение 120 вариантов в соответствующих областях BP и их влияние на сплайсинг РНК. 38 сплайсогенных вариантов были идентифицированы в 30 различных интронах; 22 варианта вызвали пропуск экзона, 10 вариантов вызвали полное удержание интрона, а шесть оставшихся вариантов активировали использование других криптических 3’ss, расположенных на расстоянии до 147 нуклеотидов перед 3′-позициями и 38 нуклеотидов ниже исходного акцепторного сайта (дополнительный файл 3: Таблица S2).

Рис. 4

Распределение интронных вариантов в области точки ветвления (от –18 до –44), экспериментально проверенных на их влияние на сплайсинг РНК ( n = 120). Позиции указаны относительно ближайшей ссылки [3] ‘ss. В черных вариантах это изменяет сплайсинг РНК. Серым цветом показан вариант без эффекта

После прогнозирования АД для каждого интрона, затронутого вариантами, мы проанализировали распределение каждого варианта в соответствии с положением прогнозируемого АД (Дополнительный файл 1: Рисунок S10).Во-первых, мы проанализировали мотивы разного размера для классификации вариантов (подробности см. В разделе «Методы»). Наилучшим общим мотивом был 4-мерный, начинающийся на 2 нт выше по потоку от A и на 1 нт ниже по течению (дополнительный файл 1: фиг. S11), что соответствует мотиву TRAY. Для мотива этого размера BPP показал лучшую точность с 89,17%, а LaBranchoR имел более низкую производительность с точностью 78,33% (Таблица 5). Branchpointer не предсказал АД для интрона 24 гена BRCA2 , что привело к пропуску точки данных, соответствующей BRCA2 c.9257-18C> Вариант.

Таблица 5 Классификация вариантов в соответствии с их положением в прогнозируемой точке ветвления ( n = 120) (Мотив 4-мер: ЛОТОК)

Как показано в Дополнительном файле 1: Рисунок S10, варианты, влияющие на сращивание, в основном находились в предполагаемых положения точки ветвления 0 (предсказанная точка ветвления A) и — 2 (нуклеотид T 2 н. перед самой точкой ветвления A). BPP выявил наибольшее количество сплайсогенных вариантов в этих позициях. Точнее, аномалии сплайсинга были обнаружены для всех десяти вариантов, встречающихся в позиции — 2, и для 15 из 18 вариантов, которые, по прогнозам, располагались в точке ветвления A.Три оставшихся варианта, по прогнозам BPP, изменят положение точки ветвления A ( BRCA1 c.4186-41A> C, MLh2 c.1668-19A> G и RAD51C c.838-25A> G), и не подтверждено экспериментально, SVM-BPfinder также предсказал, что они изменяют аденозин BP, в то время как Branchpointer и LaBranchoR помещают эти варианты вне мотивов BP.

Затем мы оценили различительную способность каждого инструмента, включая HSF, путем вычисления дельта-баллов для выявления дефектов сплайсинга из вариантов BP (рис.2в). По показателю дельты SVM-BPfinder превзошел другие инструменты с AUC 0,782. На основе этого ROC-анализа мы определили оптимальный порог принятия решения (подробности см. В разделе «Методы»), равный -0,136, то есть варианты были предсказаны как сплайсогенные, если оценка варианта была менее 13,6% от оценки дикого типа. Характеристики, достигнутые с этим порогом, представлены в таблице 6. SVM-BPfinder достиг максимальной точности 81,67%.

Таблица 6 Таблица непредвиденных обстоятельств варианта в соответствии с оценкой вариации, n = 120 вариантов

Достижение перекрестной проверки на основе модели логистической регрессии подчеркнуло эффективность комбинации инструментов BPP и Branchpointer (см. « Методы »для подробностей).Эта модель должна была предположить варианты как сплайсогенные, если они встречаются в 4-мерном мотиве ВР TRAY, предсказанном как BPP, так и Branchpointer.

Оставьте комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *